Incidental Mutation 'R6119:Msra'
ID506198
Institutional Source Beutler Lab
Gene Symbol Msra
Ensembl Gene ENSMUSG00000054733
Gene Namemethionine sulfoxide reductase A
Synonyms2310045J23Rik, MSR-A, 6530413P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R6119 (G1)
Quality Score68.0074
Status Validated
Chromosome14
Chromosomal Location64122625-64455903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64440734 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 38 (R38C)
Ref Sequence ENSEMBL: ENSMUSP00000065754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067927]
PDB Structure
Solution structure of murine myristoylated msrA [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000067927
AA Change: R38C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065754
Gene: ENSMUSG00000054733
AA Change: R38C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:PMSR 65 219 2.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209392
Meta Mutation Damage Score 0.0364 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this allele display an increased sensitivity to oxidative stress, reductions in related enzyme levels, and reduced life spans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Sftpa1 T A 14: 41,132,552 I32N probably damaging Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Msra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Msra APN 14 64123325 missense probably damaging 0.99
IGL01301:Msra APN 14 64210435 missense probably damaging 1.00
IGL02500:Msra APN 14 64285188 splice site probably benign
IGL03227:Msra APN 14 64313743 missense probably benign 0.06
ANU18:Msra UTSW 14 64210435 missense probably damaging 1.00
R0485:Msra UTSW 14 64440761 missense possibly damaging 0.64
R0632:Msra UTSW 14 64210532 missense probably benign 0.04
R1557:Msra UTSW 14 64123326 missense possibly damaging 0.75
R1940:Msra UTSW 14 64285056 splice site probably benign
R2133:Msra UTSW 14 64233928 missense probably damaging 1.00
R2135:Msra UTSW 14 64123208 missense probably damaging 1.00
R6602:Msra UTSW 14 64123339 missense probably benign 0.01
R7233:Msra UTSW 14 64123265 missense probably damaging 1.00
R7249:Msra UTSW 14 64440763 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAGTCTTTCAGAGCGAGACTC -3'
(R):5'- TTTGTCCCTCAGAGACAGCC -3'

Sequencing Primer
(F):5'- AGGAGACTGCCCAGCTGAG -3'
(R):5'- TCAGAGACAGCCAGGCCTG -3'
Posted On2018-03-08