Incidental Mutation 'R6251:Rtl1'
ID506241
Institutional Source Beutler Lab
Gene Symbol Rtl1
Ensembl Gene ENSMUSG00000085925
Gene Nameretrotransposon Gaglike 1
SynonymsMart1, Mor1, Mar
MMRRC Submission 044368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6251 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location109589193-109600330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109593649 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 585 (N585K)
Ref Sequence ENSEMBL: ENSMUSP00000115957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149046]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093625
Predicted Effect probably benign
Transcript: ENSMUST00000149046
AA Change: N585K

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: N585K

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 41 80 N/A INTRINSIC
internal_repeat_1 88 163 8.8e-50 PROSPERO
internal_repeat_1 176 251 8.8e-50 PROSPERO
low complexity region 332 361 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 393 408 N/A INTRINSIC
Pfam:DUF4939 432 538 1.6e-14 PFAM
Pfam:Retrotrans_gag 493 586 9.2e-13 PFAM
low complexity region 611 632 N/A INTRINSIC
Pfam:gag-asp_proteas 663 731 2.3e-15 PFAM
low complexity region 833 849 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
PDB:4OL8|E 988 1192 6e-17 PDB
Blast:CYCc 989 1158 5e-9 BLAST
SCOP:d1sig__ 1291 1443 2e-4 SMART
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199494
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,652 S36P probably damaging Het
AF067061 T C 13: 120,263,371 probably benign Het
Agmo A G 12: 37,252,539 D125G probably damaging Het
Arhgap26 A T 18: 39,357,827 S328C probably null Het
Arl6 T C 16: 59,618,806 D175G probably damaging Het
Asb3 G A 11: 31,055,559 A192T probably damaging Het
Atp10b A T 11: 43,235,746 M1110L possibly damaging Het
Cacna1i T C 15: 80,336,682 I175T probably damaging Het
Car15 A T 16: 17,837,363 I71N probably benign Het
Casq1 T A 1: 172,216,840 Y140F probably benign Het
Ccdc93 C T 1: 121,434,540 T17M possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Ciart G A 3: 95,881,011 probably benign Het
Cul5 A T 9: 53,646,794 V170D probably benign Het
Cyb5r3 T C 15: 83,154,716 D224G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Daglb T A 5: 143,489,934 L383Q probably damaging Het
Dazap2 T G 15: 100,616,983 H28Q possibly damaging Het
Dnttip2 A T 3: 122,275,256 D40V probably benign Het
Epn1 G T 7: 5,095,926 D406Y probably damaging Het
Epn1 G T 7: 5,095,936 R409L probably damaging Het
Evc T C 5: 37,300,499 T966A probably benign Het
Extl3 T C 14: 65,076,926 D269G probably damaging Het
Gfra3 TGCGC TGC 18: 34,695,811 probably null Het
Gm4778 G T 3: 94,265,901 S72I probably damaging Het
Gpr87 A T 3: 59,179,107 F326I probably damaging Het
Hivep3 C A 4: 120,094,940 P151H probably damaging Het
Kcnj14 T A 7: 45,818,016 E302V probably damaging Het
Kdm5d T C Y: 921,693 Y534H probably damaging Homo
Map3k5 T A 10: 20,138,260 probably null Het
Marc1 G A 1: 184,795,451 R271W probably damaging Het
Mdn1 A G 4: 32,748,590 T4212A probably benign Het
Ms4a6d A T 19: 11,587,140 S122R probably damaging Het
Nectin3 A T 16: 46,395,150 H76Q probably damaging Het
Notch1 C A 2: 26,474,170 E846D possibly damaging Het
Olfr1200 T C 2: 88,768,288 E9G probably damaging Het
Olfr1537 T A 9: 39,238,218 I72F possibly damaging Het
Olfr382 A G 11: 73,516,708 S164P probably benign Het
Olfr883 G GGGATTGC 9: 38,026,537 probably null Het
Olfr883 TGTTT TGTTTGCAGTTT 9: 38,026,545 probably null Het
Olfr883 GTTT GTTTGCTTTTT 9: 38,026,546 probably null Het
Olfr883 TT TTGCTGTGT 9: 38,026,548 probably null Het
Pfkl C T 10: 77,989,565 probably null Het
Pigz T C 16: 31,945,606 V494A possibly damaging Het
Pik3r4 T C 9: 105,654,048 V516A probably benign Het
Polr2b G A 5: 77,348,294 R1104K probably benign Het
Rap1a A T 3: 105,731,995 L116* probably null Het
Rnf114 T C 2: 167,514,729 *230R probably null Het
Serpinb5 G T 1: 106,875,065 R110I possibly damaging Het
Spink6 T C 18: 44,074,431 probably null Het
Stk39 A T 2: 68,307,039 probably null Het
Tcte1 A T 17: 45,535,159 T230S probably benign Het
Tctex1d2 T A 16: 32,426,909 D125E possibly damaging Het
Tecpr1 C A 5: 144,198,576 V1020L probably damaging Het
Tmc7 T C 7: 118,561,038 Y192C possibly damaging Het
Trim63 A T 4: 134,323,226 T274S probably benign Het
Wdr43 G A 17: 71,650,053 probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Rtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rtl1 APN 12 109593000 missense probably benign 0.00
IGL01981:Rtl1 APN 12 109591935 missense possibly damaging 0.72
IGL02418:Rtl1 APN 12 109590449 missense probably damaging 1.00
IGL03164:Rtl1 APN 12 109592933 missense probably damaging 1.00
FR4304:Rtl1 UTSW 12 109591198 small deletion probably benign
R0109:Rtl1 UTSW 12 109595407 start gained probably benign
R0141:Rtl1 UTSW 12 109592948 missense probably damaging 1.00
R0312:Rtl1 UTSW 12 109590227 missense probably damaging 0.99
R0389:Rtl1 UTSW 12 109590363 missense possibly damaging 0.77
R0390:Rtl1 UTSW 12 109591386 missense unknown
R0548:Rtl1 UTSW 12 109591655 missense probably damaging 0.98
R0561:Rtl1 UTSW 12 109593929 missense probably damaging 0.99
R0624:Rtl1 UTSW 12 109592719 missense probably damaging 0.97
R0746:Rtl1 UTSW 12 109592960 missense probably damaging 1.00
R1353:Rtl1 UTSW 12 109592199 missense probably benign 0.00
R1868:Rtl1 UTSW 12 109590536 missense probably damaging 1.00
R1935:Rtl1 UTSW 12 109591920 missense probably benign 0.42
R2000:Rtl1 UTSW 12 109593887 missense probably damaging 1.00
R2094:Rtl1 UTSW 12 109591397 missense unknown
R2125:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R2166:Rtl1 UTSW 12 109590554 missense probably damaging 1.00
R2247:Rtl1 UTSW 12 109594979 missense possibly damaging 0.77
R2274:Rtl1 UTSW 12 109594667 missense unknown
R2919:Rtl1 UTSW 12 109591148 missense unknown
R2998:Rtl1 UTSW 12 109595096 missense probably damaging 0.99
R4554:Rtl1 UTSW 12 109594328 missense possibly damaging 0.53
R4566:Rtl1 UTSW 12 109592859 missense probably damaging 1.00
R4887:Rtl1 UTSW 12 109591704 missense probably damaging 0.96
R5399:Rtl1 UTSW 12 109590302 missense probably damaging 1.00
R5512:Rtl1 UTSW 12 109591371 missense unknown
R5616:Rtl1 UTSW 12 109592739 missense unknown
R5644:Rtl1 UTSW 12 109591579 missense probably benign 0.03
R5647:Rtl1 UTSW 12 109594679 missense unknown
R5695:Rtl1 UTSW 12 109594097 missense probably damaging 1.00
R5714:Rtl1 UTSW 12 109593680 missense probably damaging 0.99
R5786:Rtl1 UTSW 12 109592619 missense possibly damaging 0.89
R5917:Rtl1 UTSW 12 109591653 missense possibly damaging 0.82
R5948:Rtl1 UTSW 12 109590599 missense possibly damaging 0.86
R6051:Rtl1 UTSW 12 109593024 missense probably damaging 1.00
R6342:Rtl1 UTSW 12 109592301 missense possibly damaging 0.50
R6433:Rtl1 UTSW 12 109595196 missense unknown
R6815:Rtl1 UTSW 12 109594503 missense probably damaging 0.98
R6968:Rtl1 UTSW 12 109594679 missense unknown
R7002:Rtl1 UTSW 12 109593947 missense probably damaging 0.97
R7020:Rtl1 UTSW 12 109592315 missense possibly damaging 0.72
R7026:Rtl1 UTSW 12 109593161 missense probably damaging 0.99
R7027:Rtl1 UTSW 12 109591414 small deletion probably benign
R7196:Rtl1 UTSW 12 109592787 missense possibly damaging 0.83
R7239:Rtl1 UTSW 12 109592475 missense probably benign 0.05
R7312:Rtl1 UTSW 12 109595238 missense unknown
Z1088:Rtl1 UTSW 12 109592319 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCGCGATCAATGTCTGGGTG -3'
(R):5'- ATGTCAGAAAAGTTTGAGTATCGGC -3'

Sequencing Primer
(F):5'- TGGAACTCATTGGGCAGC -3'
(R):5'- AGTTTGAGTATCGGCAGACCC -3'
Posted On2018-03-15