Mutagenetix > Incidental Mutation

Incidental Mutation 'R6252:Ubr1'

506264

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

044369-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.826) question?

Stock #

R6252 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120690750-120801196 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120737376 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1056 (D1056G)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably benign
Transcript: ENSMUST00000028728
AA Change: D1056G

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: D1056G

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129790

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	C	2: 69,122,305 (GRCm39)	I393V	probably benign	Het
Agl	C	T	3: 116,580,878 (GRCm39)		probably null	Het
Ankrd11	T	C	8: 123,620,561 (GRCm39)	E1097G	possibly damaging	Het
Aoc1	A	G	6: 48,883,015 (GRCm39)	H297R	probably benign	Het
AW146154	G	A	7: 41,130,811 (GRCm39)	P102S	probably benign	Het
Cap1	A	G	4: 122,766,193 (GRCm39)	V15A	probably benign	Het
Cavin2	A	G	1: 51,328,828 (GRCm39)	N95S	probably benign	Het
Col11a2	T	A	17: 34,261,186 (GRCm39)	D45E	probably null	Het
Col8a1	A	G	16: 57,447,368 (GRCm39)	V714A	unknown	Het
Crispld1	A	G	1: 17,819,731 (GRCm39)	E243G	probably benign	Het
Daam1	G	A	12: 72,035,723 (GRCm39)	G964R	probably damaging	Het
Elapor2	T	C	5: 9,460,693 (GRCm39)	Y205H	probably damaging	Het
Epg5	T	C	18: 78,028,382 (GRCm39)	F1308L	probably damaging	Het
Eqtn	A	T	4: 94,796,006 (GRCm39)	S232T	probably damaging	Het
Esyt1	T	C	10: 128,347,771 (GRCm39)	E973G	probably benign	Het
Fbxl13	T	A	5: 21,826,499 (GRCm39)	M96L	possibly damaging	Het
Frem2	A	T	3: 53,479,869 (GRCm39)	F1941L	probably damaging	Het
Gbf1	T	C	19: 46,259,995 (GRCm39)	V1050A	probably benign	Het
Hecw1	T	C	13: 14,446,664 (GRCm39)	H721R	probably damaging	Het
Idh1	T	G	1: 65,207,690 (GRCm39)	Q163P	probably benign	Het
Kctd15	A	G	7: 34,341,348 (GRCm39)	V193A	probably benign	Het
Npas3	A	G	12: 54,115,673 (GRCm39)	Y834C	probably damaging	Het
Opn4	C	T	14: 34,316,788 (GRCm39)	V334I	probably benign	Het
Or10w3	A	T	19: 13,704,419 (GRCm39)	S265C	probably damaging	Het
Pappa	A	G	4: 65,107,649 (GRCm39)	M687V	probably benign	Het
Pcdhgc5	T	C	18: 37,954,583 (GRCm39)	F619S	probably damaging	Het
Pdlim2	G	T	14: 70,405,137 (GRCm39)	Q243K	probably damaging	Het
Pkd1	T	C	17: 24,800,200 (GRCm39)	L2987P	probably damaging	Het
Plcz1	A	G	6: 139,953,329 (GRCm39)		probably null	Het
Prpf6	C	T	2: 181,289,156 (GRCm39)	A615V	probably damaging	Het
Pwp1	T	C	10: 85,710,373 (GRCm39)	V5A	probably benign	Het
Rsph10b	T	A	5: 143,873,939 (GRCm39)	D13E	possibly damaging	Het
Slc44a3	T	A	3: 121,307,386 (GRCm39)	D200V	probably damaging	Het
Spata31h1	T	C	10: 82,119,588 (GRCm39)	Q4474R	probably benign	Het
St7l	T	C	3: 104,826,819 (GRCm39)		probably null	Het
Stc2	T	A	11: 31,310,346 (GRCm39)	D230V	probably damaging	Het
Syne2	C	A	12: 76,016,210 (GRCm39)	T3264K	probably benign	Het
Trp73	C	A	4: 154,148,854 (GRCm39)	D252Y	probably damaging	Het
Vcan	C	T	13: 89,839,339 (GRCm39)	W1108*	probably null	Het
Zfp772	G	T	7: 7,207,018 (GRCm39)	S224R	possibly damaging	Het
Zfp804b	A	T	5: 6,819,478 (GRCm39)	V1159E	probably damaging	Het
Zfp981	T	G	4: 146,621,970 (GRCm39)	S298R	probably benign	Het
Zmat3	A	G	3: 32,395,770 (GRCm39)	F246L	possibly damaging	Het
Zranb1	A	G	7: 132,585,633 (GRCm39)	T720A	probably benign	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120,705,888 (GRCm39)	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120,771,574 (GRCm39)	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120,761,353 (GRCm39)	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120,745,386 (GRCm39)	missense	probably benign
IGL01346:Ubr1	APN	2	120,703,603 (GRCm39)	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120,771,612 (GRCm39)	splice site	probably benign
IGL01539:Ubr1	APN	2	120,756,494 (GRCm39)	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120,764,823 (GRCm39)	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120,705,879 (GRCm39)	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120,751,867 (GRCm39)	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120,730,989 (GRCm39)	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120,776,830 (GRCm39)	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120,694,854 (GRCm39)	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120,701,460 (GRCm39)	splice site	probably benign
IGL02627:Ubr1	APN	2	120,771,472 (GRCm39)	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120,745,364 (GRCm39)	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120,771,572 (GRCm39)	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120,711,664 (GRCm39)	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120,791,637 (GRCm39)	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120,694,898 (GRCm39)	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120,725,641 (GRCm39)	missense	probably benign
I1329:Ubr1	UTSW	2	120,764,775 (GRCm39)	splice site	probably benign
R0022:Ubr1	UTSW	2	120,791,654 (GRCm39)	splice site	probably benign
R0345:Ubr1	UTSW	2	120,734,584 (GRCm39)	splice site	probably null
R0373:Ubr1	UTSW	2	120,777,138 (GRCm39)	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120,737,427 (GRCm39)	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120,711,574 (GRCm39)	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120,778,364 (GRCm39)	nonsense	probably null
R0723:Ubr1	UTSW	2	120,711,582 (GRCm39)	nonsense	probably null
R1178:Ubr1	UTSW	2	120,756,510 (GRCm39)	nonsense	probably null
R1401:Ubr1	UTSW	2	120,786,125 (GRCm39)	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120,791,579 (GRCm39)	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120,765,800 (GRCm39)	splice site	probably benign
R1920:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120,776,754 (GRCm39)	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120,773,034 (GRCm39)	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120,694,811 (GRCm39)	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120,756,528 (GRCm39)	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120,739,963 (GRCm39)	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120,793,929 (GRCm39)	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120,746,951 (GRCm39)	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120,693,168 (GRCm39)	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4173:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4174:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4241:Ubr1	UTSW	2	120,764,867 (GRCm39)	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120,725,547 (GRCm39)	splice site	probably null
R4449:Ubr1	UTSW	2	120,776,862 (GRCm39)	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120,772,963 (GRCm39)	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120,756,494 (GRCm39)	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120,793,923 (GRCm39)	nonsense	probably null
R4928:Ubr1	UTSW	2	120,745,419 (GRCm39)	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120,794,047 (GRCm39)	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120,742,478 (GRCm39)	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120,793,903 (GRCm39)	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120,712,745 (GRCm39)	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120,723,651 (GRCm39)	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120,734,525 (GRCm39)	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120,793,981 (GRCm39)	missense	probably benign
R5452:Ubr1	UTSW	2	120,698,783 (GRCm39)	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120,745,888 (GRCm39)	missense	probably benign
R5610:Ubr1	UTSW	2	120,722,593 (GRCm39)	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120,793,998 (GRCm39)	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120,791,573 (GRCm39)	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120,734,486 (GRCm39)	missense	probably benign
R5979:Ubr1	UTSW	2	120,776,863 (GRCm39)	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120,723,690 (GRCm39)	missense	probably damaging	0.98
R6389:Ubr1	UTSW	2	120,711,520 (GRCm39)	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120,745,880 (GRCm39)	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120,754,611 (GRCm39)	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120,786,121 (GRCm39)	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120,727,156 (GRCm39)	splice site	probably null
R6994:Ubr1	UTSW	2	120,794,074 (GRCm39)	missense	probably benign
R7121:Ubr1	UTSW	2	120,705,979 (GRCm39)	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120,734,558 (GRCm39)	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120,693,246 (GRCm39)	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120,693,161 (GRCm39)	missense	probably benign
R7457:Ubr1	UTSW	2	120,748,309 (GRCm39)	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120,720,255 (GRCm39)	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120,705,925 (GRCm39)	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120,703,672 (GRCm39)	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120,764,855 (GRCm39)	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120,764,898 (GRCm39)	nonsense	probably null
R8221:Ubr1	UTSW	2	120,791,585 (GRCm39)	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120,793,937 (GRCm39)	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120,741,596 (GRCm39)	missense	probably benign
R8293:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120,701,476 (GRCm39)	missense	probably benign
R8489:Ubr1	UTSW	2	120,711,548 (GRCm39)	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120,696,964 (GRCm39)	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120,734,523 (GRCm39)	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120,697,034 (GRCm39)	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120,756,469 (GRCm39)	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120,754,615 (GRCm39)	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120,703,603 (GRCm39)	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120,778,325 (GRCm39)	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120,727,000 (GRCm39)	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120,765,765 (GRCm39)	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120,734,506 (GRCm39)	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120,703,627 (GRCm39)	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120,764,820 (GRCm39)	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120,732,092 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAGTATAAATCACATCTATTAGGCG -3'
(R):5'- ACAGGAGATCCTATCTAATTTTGGT -3'

Sequencing Primer
(F):5'- GATCTTGGAAGAATGCTTGTT -3'
(R):5'- GGTGTTACTTACCATTCAGATTACTC -3'

Posted On

2018-03-15