Incidental Mutation 'R6252:Pappa'
ID506271
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission 044369-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R6252 (G1)
Quality Score197.009
Status Not validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65189412 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 687 (M687V)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably benign
Transcript: ENSMUST00000084501
AA Change: M687V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: M687V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,754 Q4474R probably benign Het
9330182L06Rik T C 5: 9,410,693 Y205H probably damaging Het
Abcb11 T C 2: 69,291,961 I393V probably benign Het
Agl C T 3: 116,787,229 probably null Het
Ankrd11 T C 8: 122,893,822 E1097G possibly damaging Het
Aoc1 A G 6: 48,906,081 H297R probably benign Het
AW146154 G A 7: 41,481,387 P102S probably benign Het
Cap1 A G 4: 122,872,400 V15A probably benign Het
Cavin2 A G 1: 51,289,669 N95S probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Col8a1 A G 16: 57,627,005 V714A unknown Het
Crispld1 A G 1: 17,749,507 E243G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Epg5 T C 18: 77,985,167 F1308L probably damaging Het
Eqtn A T 4: 94,907,769 S232T probably damaging Het
Esyt1 T C 10: 128,511,902 E973G probably benign Het
Fbxl13 T A 5: 21,621,501 M96L possibly damaging Het
Frem2 A T 3: 53,572,448 F1941L probably damaging Het
Gbf1 T C 19: 46,271,556 V1050A probably benign Het
Hecw1 T C 13: 14,272,079 H721R probably damaging Het
Idh1 T G 1: 65,168,531 Q163P probably benign Het
Kctd15 A G 7: 34,641,923 V193A probably benign Het
Npas3 A G 12: 54,068,890 Y834C probably damaging Het
Olfr1493-ps1 A T 19: 13,727,055 S265C probably damaging Het
Opn4 C T 14: 34,594,831 V334I probably benign Het
Pcdhgc5 T C 18: 37,821,530 F619S probably damaging Het
Pdlim2 G T 14: 70,167,688 Q243K probably damaging Het
Pkd1 T C 17: 24,581,226 L2987P probably damaging Het
Plcz1 A G 6: 140,007,603 probably null Het
Prpf6 C T 2: 181,647,363 A615V probably damaging Het
Pwp1 T C 10: 85,874,509 V5A probably benign Het
Rsph10b T A 5: 143,937,121 D13E possibly damaging Het
Slc44a3 T A 3: 121,513,737 D200V probably damaging Het
St7l T C 3: 104,919,503 probably null Het
Stc2 T A 11: 31,360,346 D230V probably damaging Het
Syne2 C A 12: 75,969,436 T3264K probably benign Het
Trp73 C A 4: 154,064,397 D252Y probably damaging Het
Ubr1 T C 2: 120,906,895 D1056G probably benign Het
Vcan C T 13: 89,691,220 W1108* probably null Het
Zfp772 G T 7: 7,204,019 S224R possibly damaging Het
Zfp804b A T 5: 6,769,478 V1159E probably damaging Het
Zfp981 T G 4: 146,537,513 S298R probably benign Het
Zmat3 A G 3: 32,341,621 F246L possibly damaging Het
Zranb1 A G 7: 132,983,904 T720A probably benign Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
R7196:Pappa UTSW 4 65323891 splice site probably null
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGACGTCATTCTTCTCTTG -3'
(R):5'- AGTCACTGCTGAGTAGTGGG -3'

Sequencing Primer
(F):5'- GAGACGTCATTCTTCTCTTGCATGC -3'
(R):5'- GAGTAGTGGGTTCTTTATTCAACAAG -3'
Posted On2018-03-15