Incidental Mutation 'R6252:Zfp804b'
ID506276
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission 044369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R6252 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6769478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1159 (V1159E)
Ref Sequence ENSEMBL: ENSMUSP00000130571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect probably damaging
Transcript: ENSMUST00000164784
AA Change: V1159E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: V1159E

DomainStartEndE-ValueType
ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200317
AA Change: V1195E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: V1195E

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,754 Q4474R probably benign Het
9330182L06Rik T C 5: 9,410,693 Y205H probably damaging Het
Abcb11 T C 2: 69,291,961 I393V probably benign Het
Agl C T 3: 116,787,229 probably null Het
Ankrd11 T C 8: 122,893,822 E1097G possibly damaging Het
Aoc1 A G 6: 48,906,081 H297R probably benign Het
AW146154 G A 7: 41,481,387 P102S probably benign Het
Cap1 A G 4: 122,872,400 V15A probably benign Het
Cavin2 A G 1: 51,289,669 N95S probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Col8a1 A G 16: 57,627,005 V714A unknown Het
Crispld1 A G 1: 17,749,507 E243G probably benign Het
Daam1 G A 12: 71,988,949 G964R probably damaging Het
Epg5 T C 18: 77,985,167 F1308L probably damaging Het
Eqtn A T 4: 94,907,769 S232T probably damaging Het
Esyt1 T C 10: 128,511,902 E973G probably benign Het
Fbxl13 T A 5: 21,621,501 M96L possibly damaging Het
Frem2 A T 3: 53,572,448 F1941L probably damaging Het
Gbf1 T C 19: 46,271,556 V1050A probably benign Het
Hecw1 T C 13: 14,272,079 H721R probably damaging Het
Idh1 T G 1: 65,168,531 Q163P probably benign Het
Kctd15 A G 7: 34,641,923 V193A probably benign Het
Npas3 A G 12: 54,068,890 Y834C probably damaging Het
Olfr1493-ps1 A T 19: 13,727,055 S265C probably damaging Het
Opn4 C T 14: 34,594,831 V334I probably benign Het
Pappa A G 4: 65,189,412 M687V probably benign Het
Pcdhgc5 T C 18: 37,821,530 F619S probably damaging Het
Pdlim2 G T 14: 70,167,688 Q243K probably damaging Het
Pkd1 T C 17: 24,581,226 L2987P probably damaging Het
Plcz1 A G 6: 140,007,603 probably null Het
Prpf6 C T 2: 181,647,363 A615V probably damaging Het
Pwp1 T C 10: 85,874,509 V5A probably benign Het
Rsph10b T A 5: 143,937,121 D13E possibly damaging Het
Slc44a3 T A 3: 121,513,737 D200V probably damaging Het
St7l T C 3: 104,919,503 probably null Het
Stc2 T A 11: 31,360,346 D230V probably damaging Het
Syne2 C A 12: 75,969,436 T3264K probably benign Het
Trp73 C A 4: 154,064,397 D252Y probably damaging Het
Ubr1 T C 2: 120,906,895 D1056G probably benign Het
Vcan C T 13: 89,691,220 W1108* probably null Het
Zfp772 G T 7: 7,204,019 S224R possibly damaging Het
Zfp981 T G 4: 146,537,513 S298R probably benign Het
Zmat3 A G 3: 32,341,621 F246L possibly damaging Het
Zranb1 A G 7: 132,983,904 T720A probably benign Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense not run
R7099:Zfp804b UTSW 5 6772161 missense not run
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGGGATAATGGTTGGAGC -3'
(R):5'- TGACAGAGCTGTGCAGAAGC -3'

Sequencing Primer
(F):5'- TGGTTGGAGCAATGGTTGAAAATG -3'
(R):5'- GAAGTGTGTCATAAATCTCTGTCACC -3'
Posted On2018-03-15