Incidental Mutation 'R6253:Myom3'
ID506317
Institutional Source Beutler Lab
Gene Symbol Myom3
Ensembl Gene ENSMUSG00000037139
Gene Namemyomesin family, member 3
Synonyms8430427K15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6253 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location135759715-135815564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135785892 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 627 (D627V)
Ref Sequence ENSEMBL: ENSMUSP00000101480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105854]
Predicted Effect probably benign
Transcript: ENSMUST00000105854
AA Change: D627V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101480
Gene: ENSMUSG00000037139
AA Change: D627V

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 53 83 N/A INTRINSIC
coiled coil region 119 150 N/A INTRINSIC
IG 160 248 7.64e-9 SMART
IG 277 364 1.37e-1 SMART
FN3 374 457 4.8e-13 SMART
FN3 502 585 9.99e-11 SMART
FN3 603 684 1.74e-10 SMART
FN3 702 785 2.5e-11 SMART
FN3 804 887 7.73e-17 SMART
Blast:IG_like 904 1098 1e-100 BLAST
PDB:2JTD|A 1000 1105 4e-25 PDB
low complexity region 1107 1119 N/A INTRINSIC
IG 1127 1209 4.46e-1 SMART
IGc2 1349 1416 1.4e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,524,118 Y151H possibly damaging Het
Aasdh A G 5: 76,886,258 I482T possibly damaging Het
Abca3 G A 17: 24,397,552 M989I probably benign Het
Acvr2b C T 9: 119,428,561 P220L probably damaging Het
Aqr T C 2: 114,156,277 D204G possibly damaging Het
Arpp19 G T 9: 75,056,734 D123Y probably damaging Het
Bod1l A G 5: 41,826,538 I554T probably damaging Het
Bpifa5 A G 2: 154,163,500 M1V probably null Het
Cdh3 T A 8: 106,537,063 probably null Het
Cep170 A T 1: 176,780,394 D165E possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Cog3 A G 14: 75,719,712 L627P probably damaging Het
Col23a1 C T 11: 51,574,168 L453F probably damaging Het
Cyp2a22 T A 7: 26,934,232 Q351L probably benign Het
Ddx4 C A 13: 112,636,022 E78* probably null Het
Ddx4 T G 13: 112,636,023 K77N probably benign Het
Decr1 A T 4: 15,931,179 N92K probably benign Het
Dnm2 T C 9: 21,500,275 L600P probably damaging Het
Ece2 A C 16: 20,639,182 N356H probably damaging Het
Ern1 A T 11: 106,426,908 I130N possibly damaging Het
Fat2 G A 11: 55,296,271 R1250C probably damaging Het
Fat4 T A 3: 38,951,356 V1968D probably damaging Het
Frmd6 A G 12: 70,877,213 K82E probably damaging Het
Gm5431 A G 11: 48,894,999 V183A probably benign Het
Golgb1 T C 16: 36,915,622 S1744P possibly damaging Het
Hnrnpa3 C G 2: 75,662,570 Q213E possibly damaging Het
Hspa1a A G 17: 34,970,550 F459S probably damaging Het
Ice1 A G 13: 70,603,164 L1601P probably damaging Het
Igkv19-93 T A 6: 68,736,339 D102V probably damaging Het
Kansl1 G A 11: 104,357,526 T534I probably benign Het
Lpin2 T A 17: 71,231,269 S303R probably damaging Het
Lrpprc T A 17: 84,740,637 I845F probably benign Het
Mdn1 A G 4: 32,749,593 T4259A probably benign Het
Mtss1 A G 15: 58,943,719 I664T probably benign Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh8 A G 11: 67,301,967 E1528G probably benign Het
Myo5c A T 9: 75,245,037 E69V probably damaging Het
Olfr1336 T C 7: 6,460,548 V13A probably benign Het
Olfr17 G A 7: 107,098,257 R264H possibly damaging Het
Olfr715b A T 7: 107,105,938 S308T probably benign Het
Phactr1 T A 13: 43,094,771 S399T probably benign Het
Plch2 T A 4: 155,007,101 Y84F probably damaging Het
Ppp1r13b A G 12: 111,835,726 S278P probably benign Het
Prol1 A G 5: 88,327,877 Y42C probably damaging Het
Pum2 A G 12: 8,748,205 E906G probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rbp4 G A 19: 38,124,980 T30M probably benign Het
Selenbp1 T C 3: 94,943,846 L351P possibly damaging Het
Serpinb6b T C 13: 32,972,272 F115S probably damaging Het
Soga1 T C 2: 157,021,419 S1197G probably benign Het
Tigd3 A T 19: 5,892,842 Y87N probably damaging Het
Tigd5 T A 15: 75,911,022 L411H probably damaging Het
Ttc3 T C 16: 94,457,413 probably null Het
Uhmk1 T C 1: 170,199,880 Q416R probably damaging Het
Zfand4 T C 6: 116,273,614 F2L probably damaging Het
Zfhx3 C T 8: 108,955,388 T3153M possibly damaging Het
Zfp697 T G 3: 98,427,539 C207G possibly damaging Het
Zfp935 T C 13: 62,454,871 T172A probably benign Het
Znrf3 G T 11: 5,280,865 L883I probably benign Het
Other mutations in Myom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Myom3 APN 4 135762571 missense possibly damaging 0.66
IGL01490:Myom3 APN 4 135810778 missense possibly damaging 0.79
IGL01931:Myom3 APN 4 135789639 missense probably benign 0.05
IGL01935:Myom3 APN 4 135788381 missense probably damaging 1.00
IGL01939:Myom3 APN 4 135765589 missense possibly damaging 0.95
IGL01981:Myom3 APN 4 135785849 nonsense probably null
IGL01985:Myom3 APN 4 135765702 critical splice donor site probably null
IGL02043:Myom3 APN 4 135770675 missense probably damaging 1.00
IGL02477:Myom3 APN 4 135779368 missense probably benign 0.22
IGL02733:Myom3 APN 4 135814303 nonsense probably null
IGL03253:Myom3 APN 4 135783097 missense possibly damaging 0.85
R0359:Myom3 UTSW 4 135778143 missense probably damaging 1.00
R0525:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0665:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0668:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0690:Myom3 UTSW 4 135788426 splice site probably benign
R1235:Myom3 UTSW 4 135789543 missense probably benign 0.09
R1692:Myom3 UTSW 4 135775551 missense probably benign 0.00
R1793:Myom3 UTSW 4 135810755 missense probably benign 0.42
R1859:Myom3 UTSW 4 135779396 missense probably benign 0.01
R1863:Myom3 UTSW 4 135778037 missense probably benign
R1876:Myom3 UTSW 4 135779400 missense probably benign 0.01
R2103:Myom3 UTSW 4 135776412 missense probably benign 0.05
R2152:Myom3 UTSW 4 135803233 missense probably benign 0.05
R4633:Myom3 UTSW 4 135775699 missense probably benign 0.00
R4726:Myom3 UTSW 4 135807275 splice site probably null
R4884:Myom3 UTSW 4 135783055 missense possibly damaging 0.90
R4943:Myom3 UTSW 4 135814274 missense possibly damaging 0.73
R5040:Myom3 UTSW 4 135789659 missense probably damaging 1.00
R5151:Myom3 UTSW 4 135789572 missense probably benign 0.01
R5158:Myom3 UTSW 4 135765586 missense probably damaging 0.99
R5169:Myom3 UTSW 4 135775578 missense probably benign 0.01
R5239:Myom3 UTSW 4 135800992 splice site probably benign
R6130:Myom3 UTSW 4 135762571 missense probably benign
R6253:Myom3 UTSW 4 135801003 missense probably benign 0.00
R6331:Myom3 UTSW 4 135776377 missense possibly damaging 0.46
R6346:Myom3 UTSW 4 135806051 missense probably benign 0.00
R6502:Myom3 UTSW 4 135762513 start gained probably benign
R6613:Myom3 UTSW 4 135812459 missense possibly damaging 0.80
R6899:Myom3 UTSW 4 135803292 missense probably damaging 1.00
R6969:Myom3 UTSW 4 135801060 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCTCGACTGCTGTGAAAG -3'
(R):5'- AGCTAGCCTGGTGTACACAG -3'

Sequencing Primer
(F):5'- CGACTGCTGTGAAAGTCCTC -3'
(R):5'- GGACCGACATTAAAGGTTGTCCTC -3'
Posted On2018-03-15