Incidental Mutation 'R6253:Lpin2'
ID506362
Institutional Source Beutler Lab
Gene Symbol Lpin2
Ensembl Gene ENSMUSG00000024052
Gene Namelipin 2
Synonyms2610511G02Rik
MMRRC Submission 044370-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R6253 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71182560-71249817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71231269 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 303 (S303R)
Ref Sequence ENSEMBL: ENSMUSP00000120634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635] [ENSMUST00000135589] [ENSMUST00000156570]
Predicted Effect probably benign
Transcript: ENSMUST00000126681
AA Change: S341R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052
AA Change: S341R

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129635
AA Change: S303R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052
AA Change: S303R

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130750
Predicted Effect probably benign
Transcript: ENSMUST00000135589
SMART Domains Protein: ENSMUSP00000115061
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_N 39 152 2.3e-54 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142842
Predicted Effect probably damaging
Transcript: ENSMUST00000156570
AA Change: S303R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120634
Gene: ENSMUSG00000024052
AA Change: S303R

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 8.5e-54 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,524,118 Y151H possibly damaging Het
Aasdh A G 5: 76,886,258 I482T possibly damaging Het
Abca3 G A 17: 24,397,552 M989I probably benign Het
Acvr2b C T 9: 119,428,561 P220L probably damaging Het
Aqr T C 2: 114,156,277 D204G possibly damaging Het
Arpp19 G T 9: 75,056,734 D123Y probably damaging Het
Bod1l A G 5: 41,826,538 I554T probably damaging Het
Bpifa5 A G 2: 154,163,500 M1V probably null Het
Cdh3 T A 8: 106,537,063 probably null Het
Cep170 A T 1: 176,780,394 D165E possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Cog3 A G 14: 75,719,712 L627P probably damaging Het
Col23a1 C T 11: 51,574,168 L453F probably damaging Het
Cyp2a22 T A 7: 26,934,232 Q351L probably benign Het
Ddx4 C A 13: 112,636,022 E78* probably null Het
Ddx4 T G 13: 112,636,023 K77N probably benign Het
Decr1 A T 4: 15,931,179 N92K probably benign Het
Dnm2 T C 9: 21,500,275 L600P probably damaging Het
Ece2 A C 16: 20,639,182 N356H probably damaging Het
Ern1 A T 11: 106,426,908 I130N possibly damaging Het
Fat2 G A 11: 55,296,271 R1250C probably damaging Het
Fat4 T A 3: 38,951,356 V1968D probably damaging Het
Frmd6 A G 12: 70,877,213 K82E probably damaging Het
Gm5431 A G 11: 48,894,999 V183A probably benign Het
Golgb1 T C 16: 36,915,622 S1744P possibly damaging Het
Hnrnpa3 C G 2: 75,662,570 Q213E possibly damaging Het
Hspa1a A G 17: 34,970,550 F459S probably damaging Het
Ice1 A G 13: 70,603,164 L1601P probably damaging Het
Igkv19-93 T A 6: 68,736,339 D102V probably damaging Het
Kansl1 G A 11: 104,357,526 T534I probably benign Het
Lrpprc T A 17: 84,740,637 I845F probably benign Het
Mdn1 A G 4: 32,749,593 T4259A probably benign Het
Mtss1 A G 15: 58,943,719 I664T probably benign Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh8 A G 11: 67,301,967 E1528G probably benign Het
Myo5c A T 9: 75,245,037 E69V probably damaging Het
Myom3 A T 4: 135,785,892 D627V probably benign Het
Myom3 A G 4: 135,801,003 N1053S probably benign Het
Olfr1336 T C 7: 6,460,548 V13A probably benign Het
Olfr17 G A 7: 107,098,257 R264H possibly damaging Het
Olfr715b A T 7: 107,105,938 S308T probably benign Het
Phactr1 T A 13: 43,094,771 S399T probably benign Het
Plch2 T A 4: 155,007,101 Y84F probably damaging Het
Ppp1r13b A G 12: 111,835,726 S278P probably benign Het
Prol1 A G 5: 88,327,877 Y42C probably damaging Het
Pum2 A G 12: 8,748,205 E906G probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rbp4 G A 19: 38,124,980 T30M probably benign Het
Selenbp1 T C 3: 94,943,846 L351P possibly damaging Het
Serpinb6b T C 13: 32,972,272 F115S probably damaging Het
Soga1 T C 2: 157,021,419 S1197G probably benign Het
Tigd3 A T 19: 5,892,842 Y87N probably damaging Het
Tigd5 T A 15: 75,911,022 L411H probably damaging Het
Ttc3 T C 16: 94,457,413 probably null Het
Uhmk1 T C 1: 170,199,880 Q416R probably damaging Het
Zfand4 T C 6: 116,273,614 F2L probably damaging Het
Zfhx3 C T 8: 108,955,388 T3153M possibly damaging Het
Zfp697 T G 3: 98,427,539 C207G possibly damaging Het
Zfp935 T C 13: 62,454,871 T172A probably benign Het
Znrf3 G T 11: 5,280,865 L883I probably benign Het
Other mutations in Lpin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lpin2 APN 17 71243972 missense probably damaging 1.00
IGL01712:Lpin2 APN 17 71215068 missense probably damaging 1.00
IGL01727:Lpin2 APN 17 71246452 missense probably damaging 1.00
IGL01969:Lpin2 APN 17 71231507 missense probably benign 0.00
IGL02143:Lpin2 APN 17 71243926 missense probably damaging 1.00
IGL02600:Lpin2 APN 17 71238698 missense probably damaging 0.99
IGL02931:Lpin2 APN 17 71238683 missense probably damaging 1.00
aspen UTSW 17 71243970 nonsense probably null
R0144:Lpin2 UTSW 17 71225076 missense probably damaging 1.00
R0165:Lpin2 UTSW 17 71246519 missense probably damaging 1.00
R0367:Lpin2 UTSW 17 71215022 missense probably damaging 1.00
R0648:Lpin2 UTSW 17 71229312 missense probably benign 0.01
R1564:Lpin2 UTSW 17 71225060 missense probably benign 0.01
R1570:Lpin2 UTSW 17 71245181 nonsense probably null
R1846:Lpin2 UTSW 17 71225069 missense probably benign 0.00
R3607:Lpin2 UTSW 17 71229392 missense probably damaging 1.00
R4006:Lpin2 UTSW 17 71246501 missense probably damaging 1.00
R4526:Lpin2 UTSW 17 71237378 splice site probably null
R4705:Lpin2 UTSW 17 71232143 unclassified probably benign
R4949:Lpin2 UTSW 17 71231339 missense probably damaging 1.00
R4970:Lpin2 UTSW 17 71231334 missense probably damaging 0.98
R5099:Lpin2 UTSW 17 71243970 nonsense probably null
R5100:Lpin2 UTSW 17 71243970 nonsense probably null
R5101:Lpin2 UTSW 17 71243970 nonsense probably null
R5152:Lpin2 UTSW 17 71245159 missense probably damaging 1.00
R5216:Lpin2 UTSW 17 71242760 missense probably damaging 1.00
R5321:Lpin2 UTSW 17 71246858 missense probably damaging 1.00
R5457:Lpin2 UTSW 17 71243372 missense probably damaging 1.00
R5695:Lpin2 UTSW 17 71244803 missense probably damaging 1.00
R5786:Lpin2 UTSW 17 71230273 missense probably benign 0.03
R5869:Lpin2 UTSW 17 71232276 unclassified probably benign
R5894:Lpin2 UTSW 17 71246934 missense probably benign 0.39
R6116:Lpin2 UTSW 17 71243930 missense probably damaging 1.00
R6280:Lpin2 UTSW 17 71232248 unclassified probably benign
R6443:Lpin2 UTSW 17 71241668 missense probably benign 0.25
R6528:Lpin2 UTSW 17 71244005 missense probably damaging 1.00
R6634:Lpin2 UTSW 17 71246418 missense probably damaging 1.00
R6828:Lpin2 UTSW 17 71222128 missense probably damaging 1.00
R6885:Lpin2 UTSW 17 71215150 missense probably damaging 1.00
R6930:Lpin2 UTSW 17 71244791 missense probably damaging 1.00
R7067:Lpin2 UTSW 17 71244858 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCTCCAGTGTTTGACTCTGATG -3'
(R):5'- AGGGTCTGCATCTAATAACGATG -3'

Sequencing Primer
(F):5'- GCCAATAGTGTTCTGTTTCACAGC -3'
(R):5'- ACGATGAAATCTGAGGTGCTTC -3'
Posted On2018-03-15