Incidental Mutation 'R6253:Tigd3'
ID506364
Institutional Source Beutler Lab
Gene Symbol Tigd3
Ensembl Gene ENSMUSG00000044390
Gene Nametigger transposable element derived 3
Synonyms
MMRRC Submission 044370-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R6253 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5891139-5894107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5892842 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 87 (Y87N)
Ref Sequence ENSEMBL: ENSMUSP00000059302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055911] [ENSMUST00000118623] [ENSMUST00000136983]
Predicted Effect probably benign
Transcript: ENSMUST00000025746
SMART Domains Protein: ENSMUSP00000025746
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 1 40 1.4e-19 PFAM
low complexity region 115 131 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 165 188 4.47e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000055911
AA Change: Y87N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059302
Gene: ENSMUSG00000044390
AA Change: Y87N

DomainStartEndE-ValueType
Pfam:CENP-B_N 6 59 2.5e-15 PFAM
CENPB 73 137 2.96e-7 SMART
Pfam:DDE_1 192 360 7.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118623
SMART Domains Protein: ENSMUSP00000113465
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 13 84 7.9e-40 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 178 196 N/A INTRINSIC
PDB:3IUF|A 203 263 1e-21 PDB
PHD 286 342 8.64e-9 SMART
RING 287 341 3.83e0 SMART
PHD 343 389 8.9e-11 SMART
RING 344 388 9.75e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136983
SMART Domains Protein: ENSMUSP00000120125
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 12 85 6.2e-41 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 178 196 N/A INTRINSIC
ZnF_C2H2 209 232 4.47e-3 SMART
PHD 272 328 8.64e-9 SMART
RING 273 327 3.83e0 SMART
PHD 329 375 8.9e-11 SMART
RING 330 374 9.75e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,524,118 Y151H possibly damaging Het
Aasdh A G 5: 76,886,258 I482T possibly damaging Het
Abca3 G A 17: 24,397,552 M989I probably benign Het
Acvr2b C T 9: 119,428,561 P220L probably damaging Het
Aqr T C 2: 114,156,277 D204G possibly damaging Het
Arpp19 G T 9: 75,056,734 D123Y probably damaging Het
Bod1l A G 5: 41,826,538 I554T probably damaging Het
Bpifa5 A G 2: 154,163,500 M1V probably null Het
Cdh3 T A 8: 106,537,063 probably null Het
Cep170 A T 1: 176,780,394 D165E possibly damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Cog3 A G 14: 75,719,712 L627P probably damaging Het
Col23a1 C T 11: 51,574,168 L453F probably damaging Het
Cyp2a22 T A 7: 26,934,232 Q351L probably benign Het
Ddx4 C A 13: 112,636,022 E78* probably null Het
Ddx4 T G 13: 112,636,023 K77N probably benign Het
Decr1 A T 4: 15,931,179 N92K probably benign Het
Dnm2 T C 9: 21,500,275 L600P probably damaging Het
Ece2 A C 16: 20,639,182 N356H probably damaging Het
Ern1 A T 11: 106,426,908 I130N possibly damaging Het
Fat2 G A 11: 55,296,271 R1250C probably damaging Het
Fat4 T A 3: 38,951,356 V1968D probably damaging Het
Frmd6 A G 12: 70,877,213 K82E probably damaging Het
Gm5431 A G 11: 48,894,999 V183A probably benign Het
Golgb1 T C 16: 36,915,622 S1744P possibly damaging Het
Hnrnpa3 C G 2: 75,662,570 Q213E possibly damaging Het
Hspa1a A G 17: 34,970,550 F459S probably damaging Het
Ice1 A G 13: 70,603,164 L1601P probably damaging Het
Igkv19-93 T A 6: 68,736,339 D102V probably damaging Het
Kansl1 G A 11: 104,357,526 T534I probably benign Het
Lpin2 T A 17: 71,231,269 S303R probably damaging Het
Lrpprc T A 17: 84,740,637 I845F probably benign Het
Mdn1 A G 4: 32,749,593 T4259A probably benign Het
Mtss1 A G 15: 58,943,719 I664T probably benign Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh8 A G 11: 67,301,967 E1528G probably benign Het
Myo5c A T 9: 75,245,037 E69V probably damaging Het
Myom3 A T 4: 135,785,892 D627V probably benign Het
Myom3 A G 4: 135,801,003 N1053S probably benign Het
Olfr1336 T C 7: 6,460,548 V13A probably benign Het
Olfr17 G A 7: 107,098,257 R264H possibly damaging Het
Olfr715b A T 7: 107,105,938 S308T probably benign Het
Phactr1 T A 13: 43,094,771 S399T probably benign Het
Plch2 T A 4: 155,007,101 Y84F probably damaging Het
Ppp1r13b A G 12: 111,835,726 S278P probably benign Het
Prol1 A G 5: 88,327,877 Y42C probably damaging Het
Pum2 A G 12: 8,748,205 E906G probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rbp4 G A 19: 38,124,980 T30M probably benign Het
Selenbp1 T C 3: 94,943,846 L351P possibly damaging Het
Serpinb6b T C 13: 32,972,272 F115S probably damaging Het
Soga1 T C 2: 157,021,419 S1197G probably benign Het
Tigd5 T A 15: 75,911,022 L411H probably damaging Het
Ttc3 T C 16: 94,457,413 probably null Het
Uhmk1 T C 1: 170,199,880 Q416R probably damaging Het
Zfand4 T C 6: 116,273,614 F2L probably damaging Het
Zfhx3 C T 8: 108,955,388 T3153M possibly damaging Het
Zfp697 T G 3: 98,427,539 C207G possibly damaging Het
Zfp935 T C 13: 62,454,871 T172A probably benign Het
Znrf3 G T 11: 5,280,865 L883I probably benign Het
Other mutations in Tigd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0456:Tigd3 UTSW 19 5892793 missense probably damaging 1.00
R0699:Tigd3 UTSW 19 5891946 missense probably benign
R1416:Tigd3 UTSW 19 5891725 missense probably benign
R3945:Tigd3 UTSW 19 5892433 missense probably damaging 0.98
R5945:Tigd3 UTSW 19 5891866 missense probably benign
R7189:Tigd3 UTSW 19 5893022 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AACTGCAGGAGGAGCTTCAG -3'
(R):5'- CTGAGAAGATCCAGGTGCTG -3'

Sequencing Primer
(F):5'- CTTCAGGAGGGAACAGAGGGAC -3'
(R):5'- TGAGTCTAAGATGTCCCAGTCAG -3'
Posted On2018-03-15