Incidental Mutation 'R6258:Pla2g4a'
ID506446
Institutional Source Beutler Lab
Gene Symbol Pla2g4a
Ensembl Gene ENSMUSG00000056220
Gene Namephospholipase A2, group IVA (cytosolic, calcium-dependent)
SynonymsType IV PLA2, cytosolic phospholipase A2, Pla2g4, cytosolic PLA2, cPLA2alpha, cPLA2
MMRRC Submission 044375-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R6258 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location149829618-149961290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149857487 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 504 (S504P)
Ref Sequence ENSEMBL: ENSMUSP00000107557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070200] [ENSMUST00000111926]
Predicted Effect probably benign
Transcript: ENSMUST00000070200
AA Change: S512P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070868
Gene: ENSMUSG00000056220
AA Change: S512P

DomainStartEndE-ValueType
C2 19 121 8.23e-17 SMART
PLAc 117 668 N/A SMART
Blast:PLAc 706 748 3e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111926
AA Change: S504P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107557
Gene: ENSMUSG00000056220
AA Change: S504P

DomainStartEndE-ValueType
C2 11 113 8.23e-17 SMART
PLAc 109 660 N/A SMART
Blast:PLAc 698 740 3e-10 BLAST
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the phospholipase A2 group IV family. This enzyme hydrolyzes membrane phospholipids, thereby releasing the polyunsaturated fatty acid, arachidonic acid. Arachidonic acid is further metabolized into eicosanoids such as leukotrienes, thromboxanes and prostaglandins, that play important roles in regulating diverse biological processes such as inflammatory responses, membrane and actin dynamics, and tumorigenesis. A rise in intracellular calcium levels results in binding of calcium to the C2 domain of this protein, and triggers the translocation from the cytosol to intracellular membranes, including the Golgi apparatus. Disruption of this gene in mice led to decreased levels of eicosonaoids and platelet-activating factor, decreased allergic symptoms, and impaired reproductive ability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygouse for disruptions in this gene display reduced allergic and autoimmune reactions. They also display an increased incidence of insulin and reduced female reproductive performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,676,567 H339R probably benign Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
AU041133 A G 10: 82,151,158 E215G probably damaging Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Casr A G 16: 36,517,609 C60R probably damaging Het
Cdc7 A G 5: 106,969,227 K84E probably damaging Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Clcc1 G A 3: 108,673,308 V313I possibly damaging Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Egflam T A 15: 7,234,292 T726S probably damaging Het
Eml2 T G 7: 19,179,364 probably null Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Faiml T C 9: 99,232,460 I125M possibly damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Fbxw2 A T 2: 34,812,813 probably null Het
Fgd6 T A 10: 94,044,299 N338K probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm32742 T A 9: 51,157,562 I200F probably damaging Het
Gm35339 C A 15: 76,355,695 S277* probably null Het
Gm4924 T G 10: 82,377,473 probably benign Het
Gm8369 G A 19: 11,511,609 A87T possibly damaging Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Ighv5-8 A G 12: 113,654,991 T9A possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jakmip1 G T 5: 37,141,760 E775* probably null Het
Klhl40 T C 9: 121,777,960 F62S probably damaging Het
Krtcap3 A T 5: 31,252,228 R84W probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 T C 7: 66,710,748 probably null Het
Magi3 A G 3: 104,089,596 L211P probably damaging Het
Map2k5 T A 9: 63,217,365 I359F probably benign Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mef2c T A 13: 83,652,938 D252E probably damaging Het
Methig1 T C 15: 100,353,541 V111A possibly damaging Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Nf1 A T 11: 79,565,755 probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr485 T C 7: 108,158,974 N300D probably damaging Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pde7b T C 10: 20,440,800 D168G possibly damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Samm50 C G 15: 84,200,311 P150A probably damaging Het
Samm50 C A 15: 84,200,312 P150H probably damaging Het
Slc6a18 A T 13: 73,670,045 C284* probably null Het
Smc3 T A 19: 53,627,731 probably null Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
Sucnr1 T C 3: 60,086,357 L102P probably damaging Het
Tbc1d9 T C 8: 83,210,516 W76R probably damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ubr3 A G 2: 69,982,864 probably null Het
Ung A T 5: 114,137,300 Y250F probably benign Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zscan4-ps1 C A 7: 11,065,902 E353D probably benign Het
Other mutations in Pla2g4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Pla2g4a APN 1 149886203 missense probably benign 0.08
IGL00763:Pla2g4a APN 1 149851325 missense probably damaging 1.00
IGL01548:Pla2g4a APN 1 149932656 critical splice donor site probably null
IGL01683:Pla2g4a APN 1 149857654 missense probably benign 0.05
IGL01903:Pla2g4a APN 1 149840619 missense possibly damaging 0.51
IGL02049:Pla2g4a APN 1 149861096 missense probably benign 0.12
IGL02103:Pla2g4a APN 1 149901199 missense probably damaging 0.99
IGL03132:Pla2g4a APN 1 149902284 splice site probably benign
IGL03299:Pla2g4a APN 1 149851367 missense probably damaging 1.00
IGL03302:Pla2g4a APN 1 149864947 missense probably benign 0.00
R0110:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0469:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0488:Pla2g4a UTSW 1 149871445 missense probably damaging 1.00
R0606:Pla2g4a UTSW 1 149840704 missense probably benign 0.44
R1468:Pla2g4a UTSW 1 149887593 splice site probably benign
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1521:Pla2g4a UTSW 1 149857686 critical splice acceptor site probably null
R1718:Pla2g4a UTSW 1 149871523 splice site probably benign
R1778:Pla2g4a UTSW 1 149902445 splice site probably benign
R1967:Pla2g4a UTSW 1 149922081 missense probably damaging 1.00
R2063:Pla2g4a UTSW 1 149840676 missense possibly damaging 0.94
R2291:Pla2g4a UTSW 1 149901189 missense probably damaging 1.00
R3855:Pla2g4a UTSW 1 149830177 missense possibly damaging 0.86
R4512:Pla2g4a UTSW 1 149861051 splice site probably null
R4568:Pla2g4a UTSW 1 149842226 missense probably benign 0.43
R5266:Pla2g4a UTSW 1 149865167 missense possibly damaging 0.79
R5855:Pla2g4a UTSW 1 149880063 missense probably damaging 0.99
R5897:Pla2g4a UTSW 1 149865148 missense probably damaging 0.99
R6012:Pla2g4a UTSW 1 149932677 missense possibly damaging 0.55
R6193:Pla2g4a UTSW 1 149902430 missense probably damaging 1.00
R6246:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6248:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6260:Pla2g4a UTSW 1 149857487 missense probably benign 0.00
R6293:Pla2g4a UTSW 1 149880047 missense probably damaging 0.98
R6310:Pla2g4a UTSW 1 149842226 missense possibly damaging 0.88
R6490:Pla2g4a UTSW 1 149851335 nonsense probably null
R6502:Pla2g4a UTSW 1 149872616 nonsense probably null
R6614:Pla2g4a UTSW 1 149842235 missense probably benign 0.07
R6671:Pla2g4a UTSW 1 149887631 missense probably benign
R6745:Pla2g4a UTSW 1 149886230 missense probably benign 0.07
R6880:Pla2g4a UTSW 1 149851451 missense possibly damaging 0.90
R7058:Pla2g4a UTSW 1 149851352 missense probably damaging 1.00
R7163:Pla2g4a UTSW 1 149840665 nonsense probably null
X0021:Pla2g4a UTSW 1 149864926 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCTAGGCCATTACCTAACCAATG -3'
(R):5'- CCTTCAGGCACCGAGAATGAAG -3'

Sequencing Primer
(F):5'- TTCAATAGTAGCAGTAGTAGTAGTGG -3'
(R):5'- GCACCGAGAATGAAGAAGCTG -3'
Posted On2018-03-15