Incidental Mutation 'R6258:Cdc7'
ID506465
Institutional Source Beutler Lab
Gene Symbol Cdc7
Ensembl Gene ENSMUSG00000029283
Gene Namecell division cycle 7 (S. cerevisiae)
SynonymsCdc7, muCdc7, Cdc7l1
MMRRC Submission 044375-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6258 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location106964322-106984432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106969227 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 84 (K84E)
Ref Sequence ENSEMBL: ENSMUSP00000119612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031221] [ENSMUST00000076467] [ENSMUST00000117196] [ENSMUST00000118261] [ENSMUST00000129938]
Predicted Effect probably damaging
Transcript: ENSMUST00000031221
AA Change: K84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031221
Gene: ENSMUSG00000029283
AA Change: K84E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 212 1.7e-14 PFAM
Pfam:Pkinase 52 216 4.4e-27 PFAM
Pfam:Pkinase 351 559 1.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076467
AA Change: K84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075792
Gene: ENSMUSG00000029283
AA Change: K84E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.7e-14 PFAM
Pfam:Pkinase 52 227 1.1e-25 PFAM
Pfam:Pkinase 314 520 2.5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117196
AA Change: K84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112392
Gene: ENSMUSG00000029283
AA Change: K84E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1e-14 PFAM
Pfam:Pkinase 52 227 6.6e-26 PFAM
Pfam:Pkinase 313 527 4.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118261
AA Change: K84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113385
Gene: ENSMUSG00000029283
AA Change: K84E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.2e-14 PFAM
Pfam:Pkinase 52 227 7.4e-26 PFAM
Pfam:Pkinase 345 559 5.1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129938
AA Change: K84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119612
Gene: ENSMUSG00000029283
AA Change: K84E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 5.4e-15 PFAM
Pfam:Pkinase 52 227 3.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140378
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell division cycle protein with kinase activity that is critical for the G1/S transition. The yeast homolog is also essential for initiation of DNA replication as cell division occurs. Overexpression of this gene product may be associated with neoplastic transformation for some tumors. Multiple alternatively spliced transcript variants that encode the same protein have been detected. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5-E6.5. In conjunction with a Trp53-null allele, double homozygous mutant embryos survive up to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,676,567 H339R probably benign Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
AU041133 A G 10: 82,151,158 E215G probably damaging Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Casr A G 16: 36,517,609 C60R probably damaging Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Clcc1 G A 3: 108,673,308 V313I possibly damaging Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Egflam T A 15: 7,234,292 T726S probably damaging Het
Eml2 T G 7: 19,179,364 probably null Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Faiml T C 9: 99,232,460 I125M possibly damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Fbxw2 A T 2: 34,812,813 probably null Het
Fgd6 T A 10: 94,044,299 N338K probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm32742 T A 9: 51,157,562 I200F probably damaging Het
Gm35339 C A 15: 76,355,695 S277* probably null Het
Gm4924 T G 10: 82,377,473 probably benign Het
Gm8369 G A 19: 11,511,609 A87T possibly damaging Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Ighv5-8 A G 12: 113,654,991 T9A possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jakmip1 G T 5: 37,141,760 E775* probably null Het
Klhl40 T C 9: 121,777,960 F62S probably damaging Het
Krtcap3 A T 5: 31,252,228 R84W probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 T C 7: 66,710,748 probably null Het
Magi3 A G 3: 104,089,596 L211P probably damaging Het
Map2k5 T A 9: 63,217,365 I359F probably benign Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mef2c T A 13: 83,652,938 D252E probably damaging Het
Methig1 T C 15: 100,353,541 V111A possibly damaging Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Nf1 A T 11: 79,565,755 probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr485 T C 7: 108,158,974 N300D probably damaging Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pde7b T C 10: 20,440,800 D168G possibly damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Samm50 C G 15: 84,200,311 P150A probably damaging Het
Samm50 C A 15: 84,200,312 P150H probably damaging Het
Slc6a18 A T 13: 73,670,045 C284* probably null Het
Smc3 T A 19: 53,627,731 probably null Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
Sucnr1 T C 3: 60,086,357 L102P probably damaging Het
Tbc1d9 T C 8: 83,210,516 W76R probably damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ubr3 A G 2: 69,982,864 probably null Het
Ung A T 5: 114,137,300 Y250F probably benign Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zscan4-ps1 C A 7: 11,065,902 E353D probably benign Het
Other mutations in Cdc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Cdc7 APN 5 106968860 missense probably benign
IGL01671:Cdc7 APN 5 106983245 missense probably damaging 1.00
IGL03373:Cdc7 APN 5 106972919 splice site probably benign
R0179:Cdc7 UTSW 5 106965039 missense probably benign 0.02
R0563:Cdc7 UTSW 5 106972910 splice site probably benign
R1621:Cdc7 UTSW 5 106965054 missense probably benign
R1970:Cdc7 UTSW 5 106973074 splice site probably benign
R2044:Cdc7 UTSW 5 106983132 missense probably benign
R2993:Cdc7 UTSW 5 106973898 missense probably benign
R3110:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R3112:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R4700:Cdc7 UTSW 5 106973841 missense probably benign 0.00
R5396:Cdc7 UTSW 5 106969297 splice site probably null
R6217:Cdc7 UTSW 5 106972794 missense probably damaging 1.00
R6285:Cdc7 UTSW 5 106983059 missense probably benign 0.00
R6609:Cdc7 UTSW 5 106973058 missense probably benign 0.04
V8831:Cdc7 UTSW 5 106968910 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAATAGTGGTAGGAACTGTGGTAAC -3'
(R):5'- ACACTGTAATTTAGGCACAAGCTC -3'

Sequencing Primer
(F):5'- AACAAGTTTTCTCCTCCTTTCAACAG -3'
(R):5'- TGTAATTTAGGCACAAGCTCACCATC -3'
Posted On2018-03-15