Incidental Mutation 'R6258:Cntn3'
ID506470
Institutional Source Beutler Lab
Gene Symbol Cntn3
Ensembl Gene ENSMUSG00000030075
Gene Namecontactin 3
SynonymsPang
MMRRC Submission 044375-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6258 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location102162655-102573101 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 102277217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]
Predicted Effect probably null
Transcript: ENSMUST00000032159
SMART Domains Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203050
Predicted Effect probably null
Transcript: ENSMUST00000203619
SMART Domains Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204857
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,676,567 H339R probably benign Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
AU041133 A G 10: 82,151,158 E215G probably damaging Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Casr A G 16: 36,517,609 C60R probably damaging Het
Cdc7 A G 5: 106,969,227 K84E probably damaging Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Clcc1 G A 3: 108,673,308 V313I possibly damaging Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Egflam T A 15: 7,234,292 T726S probably damaging Het
Eml2 T G 7: 19,179,364 probably null Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Faiml T C 9: 99,232,460 I125M possibly damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Fbxw2 A T 2: 34,812,813 probably null Het
Fgd6 T A 10: 94,044,299 N338K probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm32742 T A 9: 51,157,562 I200F probably damaging Het
Gm35339 C A 15: 76,355,695 S277* probably null Het
Gm4924 T G 10: 82,377,473 probably benign Het
Gm8369 G A 19: 11,511,609 A87T possibly damaging Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Ighv5-8 A G 12: 113,654,991 T9A possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jakmip1 G T 5: 37,141,760 E775* probably null Het
Klhl40 T C 9: 121,777,960 F62S probably damaging Het
Krtcap3 A T 5: 31,252,228 R84W probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 T C 7: 66,710,748 probably null Het
Magi3 A G 3: 104,089,596 L211P probably damaging Het
Map2k5 T A 9: 63,217,365 I359F probably benign Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mef2c T A 13: 83,652,938 D252E probably damaging Het
Methig1 T C 15: 100,353,541 V111A possibly damaging Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Nf1 A T 11: 79,565,755 probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr485 T C 7: 108,158,974 N300D probably damaging Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pde7b T C 10: 20,440,800 D168G possibly damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Samm50 C G 15: 84,200,311 P150A probably damaging Het
Samm50 C A 15: 84,200,312 P150H probably damaging Het
Slc6a18 A T 13: 73,670,045 C284* probably null Het
Smc3 T A 19: 53,627,731 probably null Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
Sucnr1 T C 3: 60,086,357 L102P probably damaging Het
Tbc1d9 T C 8: 83,210,516 W76R probably damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ubr3 A G 2: 69,982,864 probably null Het
Ung A T 5: 114,137,300 Y250F probably benign Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zscan4-ps1 C A 7: 11,065,902 E353D probably benign Het
Other mutations in Cntn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Cntn3 APN 6 102420262 nonsense probably null
IGL00706:Cntn3 APN 6 102203949 missense probably benign 0.11
IGL01071:Cntn3 APN 6 102420251 critical splice donor site probably null
IGL01769:Cntn3 APN 6 102208184 missense probably damaging 1.00
IGL01995:Cntn3 APN 6 102203885 missense probably damaging 1.00
IGL02058:Cntn3 APN 6 102199360 splice site probably benign
IGL02736:Cntn3 APN 6 102203939 missense probably damaging 1.00
IGL02955:Cntn3 APN 6 102278301 missense probably damaging 1.00
IGL02971:Cntn3 APN 6 102168933 missense probably damaging 1.00
IGL03208:Cntn3 APN 6 102187099 missense probably damaging 0.99
P0037:Cntn3 UTSW 6 102209274 missense probably damaging 1.00
PIT4431001:Cntn3 UTSW 6 102464566 missense probably benign 0.22
R0314:Cntn3 UTSW 6 102420381 missense probably damaging 1.00
R0388:Cntn3 UTSW 6 102277316 missense probably damaging 0.96
R0483:Cntn3 UTSW 6 102203966 missense probably damaging 1.00
R0539:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R0543:Cntn3 UTSW 6 102269090 splice site probably benign
R0629:Cntn3 UTSW 6 102203976 missense probably damaging 1.00
R0691:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0693:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0781:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1110:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1144:Cntn3 UTSW 6 102242126 missense possibly damaging 0.65
R1503:Cntn3 UTSW 6 102464565 nonsense probably null
R1640:Cntn3 UTSW 6 102242013 missense possibly damaging 0.82
R1681:Cntn3 UTSW 6 102170668 missense probably damaging 1.00
R1770:Cntn3 UTSW 6 102269205 missense possibly damaging 0.49
R1782:Cntn3 UTSW 6 102273811 missense probably damaging 0.97
R1861:Cntn3 UTSW 6 102245071 missense probably benign 0.11
R1930:Cntn3 UTSW 6 102242053 nonsense probably null
R2026:Cntn3 UTSW 6 102420427 missense probably damaging 1.00
R2152:Cntn3 UTSW 6 102206537 missense probably damaging 1.00
R2313:Cntn3 UTSW 6 102203928 missense probably benign
R2351:Cntn3 UTSW 6 102337383 missense possibly damaging 0.55
R3611:Cntn3 UTSW 6 102208077 missense possibly damaging 0.77
R4349:Cntn3 UTSW 6 102199351 missense probably damaging 1.00
R4421:Cntn3 UTSW 6 102464547 missense probably damaging 0.97
R4513:Cntn3 UTSW 6 102168982 missense probably benign 0.37
R4678:Cntn3 UTSW 6 102204020 missense probably damaging 1.00
R4702:Cntn3 UTSW 6 102165331 missense probably benign 0.37
R4720:Cntn3 UTSW 6 102242022 missense possibly damaging 0.65
R4879:Cntn3 UTSW 6 102267428 missense possibly damaging 0.47
R4951:Cntn3 UTSW 6 102169025 missense possibly damaging 0.90
R5410:Cntn3 UTSW 6 102278353 missense probably benign 0.01
R5502:Cntn3 UTSW 6 102265334 missense possibly damaging 0.58
R5852:Cntn3 UTSW 6 102420416 missense probably damaging 1.00
R5903:Cntn3 UTSW 6 102242133 missense probably benign 0.00
R6193:Cntn3 UTSW 6 102208131 missense probably benign 0.31
R6260:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R6350:Cntn3 UTSW 6 102170618 missense probably damaging 1.00
R6490:Cntn3 UTSW 6 102278340 missense probably damaging 0.99
R6993:Cntn3 UTSW 6 102278404 missense probably damaging 0.98
R7064:Cntn3 UTSW 6 102273811 missense probably damaging 0.97
R7085:Cntn3 UTSW 6 102165401 missense possibly damaging 0.85
R7174:Cntn3 UTSW 6 102165344 missense probably benign
R7208:Cntn3 UTSW 6 102278422 nonsense probably null
Z1088:Cntn3 UTSW 6 102420294 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTCAGGATTAAGGGTTGCAAAC -3'
(R):5'- TTGCAACCACTGAAAGTTGGTTC -3'

Sequencing Primer
(F):5'- TCAGGATTAAGGGTTGCAAACAGTAG -3'
(R):5'- CAACCACTGAAAGTTGGTTCAAAAG -3'
Posted On2018-03-15