Incidental Mutation 'R6258:Mical3'
ID506471
Institutional Source Beutler Lab
Gene Symbol Mical3
Ensembl Gene ENSMUSG00000051586
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 3
SynonymsMICAL-3, C130040D16Rik
MMRRC Submission 044375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6258 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location120931707-121130999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121009030 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 150 (L150Q)
Ref Sequence ENSEMBL: ENSMUSP00000144882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077159] [ENSMUST00000203254] [ENSMUST00000204302] [ENSMUST00000205030] [ENSMUST00000207889]
Predicted Effect probably damaging
Transcript: ENSMUST00000077159
AA Change: L798Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076402
Gene: ENSMUSG00000051586
AA Change: L798Q

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 1.4e-7 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 4.44e-17 SMART
low complexity region 625 635 N/A INTRINSIC
LIM 763 815 2.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203254
SMART Domains Protein: ENSMUSP00000145254
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 8.6e-6 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 2.2e-19 SMART
low complexity region 640 655 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204302
AA Change: L117Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144972
Gene: ENSMUSG00000051586
AA Change: L117Q

DomainStartEndE-ValueType
LIM 82 136 5.39e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205030
AA Change: L150Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144882
Gene: ENSMUSG00000051586
AA Change: L150Q

DomainStartEndE-ValueType
LIM 115 167 1.4e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207889
AA Change: L798Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000212208
AA Change: L384Q
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,676,567 H339R probably benign Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
AU041133 A G 10: 82,151,158 E215G probably damaging Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Casr A G 16: 36,517,609 C60R probably damaging Het
Cdc7 A G 5: 106,969,227 K84E probably damaging Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Clcc1 G A 3: 108,673,308 V313I possibly damaging Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Egflam T A 15: 7,234,292 T726S probably damaging Het
Eml2 T G 7: 19,179,364 probably null Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Faiml T C 9: 99,232,460 I125M possibly damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Fbxw2 A T 2: 34,812,813 probably null Het
Fgd6 T A 10: 94,044,299 N338K probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm32742 T A 9: 51,157,562 I200F probably damaging Het
Gm35339 C A 15: 76,355,695 S277* probably null Het
Gm4924 T G 10: 82,377,473 probably benign Het
Gm8369 G A 19: 11,511,609 A87T possibly damaging Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Ighv5-8 A G 12: 113,654,991 T9A possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jakmip1 G T 5: 37,141,760 E775* probably null Het
Klhl40 T C 9: 121,777,960 F62S probably damaging Het
Krtcap3 A T 5: 31,252,228 R84W probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 T C 7: 66,710,748 probably null Het
Magi3 A G 3: 104,089,596 L211P probably damaging Het
Map2k5 T A 9: 63,217,365 I359F probably benign Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mef2c T A 13: 83,652,938 D252E probably damaging Het
Methig1 T C 15: 100,353,541 V111A possibly damaging Het
Nf1 A T 11: 79,565,755 probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr485 T C 7: 108,158,974 N300D probably damaging Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pde7b T C 10: 20,440,800 D168G possibly damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Samm50 C G 15: 84,200,311 P150A probably damaging Het
Samm50 C A 15: 84,200,312 P150H probably damaging Het
Slc6a18 A T 13: 73,670,045 C284* probably null Het
Smc3 T A 19: 53,627,731 probably null Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
Sucnr1 T C 3: 60,086,357 L102P probably damaging Het
Tbc1d9 T C 8: 83,210,516 W76R probably damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ubr3 A G 2: 69,982,864 probably null Het
Ung A T 5: 114,137,300 Y250F probably benign Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zscan4-ps1 C A 7: 11,065,902 E353D probably benign Het
Other mutations in Mical3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Mical3 APN 6 120961624 missense possibly damaging 0.73
IGL00718:Mical3 APN 6 121040449 missense probably damaging 0.98
IGL00940:Mical3 APN 6 121022410 missense possibly damaging 0.55
IGL00973:Mical3 APN 6 120934924 splice site probably benign
IGL01503:Mical3 APN 6 120958576 missense probably benign 0.09
IGL01991:Mical3 APN 6 120935211 missense probably damaging 0.98
IGL02794:Mical3 APN 6 121007309 missense probably damaging 0.99
IGL02996:Mical3 APN 6 120958558 missense probably damaging 1.00
IGL03105:Mical3 APN 6 121042238 missense probably benign 0.01
IGL03109:Mical3 APN 6 121009124 missense probably damaging 1.00
IGL03236:Mical3 APN 6 120969384 missense probably benign 0.00
P0028:Mical3 UTSW 6 121024689 missense probably benign 0.33
R0244:Mical3 UTSW 6 120957722 missense probably benign 0.00
R0494:Mical3 UTSW 6 120959201 missense possibly damaging 0.94
R0586:Mical3 UTSW 6 121029641 unclassified probably benign
R1029:Mical3 UTSW 6 120934678 missense probably benign 0.02
R1263:Mical3 UTSW 6 120952469 missense probably damaging 0.99
R1507:Mical3 UTSW 6 121042238 missense probably benign 0.36
R1527:Mical3 UTSW 6 121024779 missense probably damaging 0.99
R1623:Mical3 UTSW 6 121024807 missense probably damaging 0.99
R1680:Mical3 UTSW 6 120959643 missense probably benign 0.09
R1697:Mical3 UTSW 6 121007408 missense possibly damaging 0.84
R1817:Mical3 UTSW 6 121042235 missense probably benign 0.06
R1875:Mical3 UTSW 6 121042064 missense probably damaging 1.00
R1961:Mical3 UTSW 6 120982607 missense possibly damaging 0.94
R2004:Mical3 UTSW 6 120951322 missense probably damaging 1.00
R2093:Mical3 UTSW 6 121040386 missense probably damaging 1.00
R2141:Mical3 UTSW 6 121031134 splice site probably null
R2142:Mical3 UTSW 6 121031134 splice site probably null
R2257:Mical3 UTSW 6 121033735 missense possibly damaging 0.94
R2404:Mical3 UTSW 6 120959828 missense probably benign 0.01
R2419:Mical3 UTSW 6 120959923 missense probably benign
R2509:Mical3 UTSW 6 121034157 missense probably damaging 1.00
R3784:Mical3 UTSW 6 121021337 missense probably benign 0.00
R4342:Mical3 UTSW 6 120934838 nonsense probably null
R4343:Mical3 UTSW 6 120934838 nonsense probably null
R4579:Mical3 UTSW 6 120958699 missense probably benign
R4603:Mical3 UTSW 6 120934838 nonsense probably null
R4605:Mical3 UTSW 6 121034080 nonsense probably null
R4610:Mical3 UTSW 6 120934838 nonsense probably null
R4611:Mical3 UTSW 6 120934838 nonsense probably null
R4623:Mical3 UTSW 6 120961625 nonsense probably null
R4669:Mical3 UTSW 6 120957703 missense probably damaging 0.98
R4704:Mical3 UTSW 6 120958688 missense probably benign 0.00
R4722:Mical3 UTSW 6 121038525 missense probably benign 0.00
R4863:Mical3 UTSW 6 121033787 missense probably damaging 0.99
R4878:Mical3 UTSW 6 120969387 missense possibly damaging 0.51
R4885:Mical3 UTSW 6 120935253 missense probably damaging 1.00
R4907:Mical3 UTSW 6 121007298 missense probably benign 0.00
R5007:Mical3 UTSW 6 121038069 missense probably damaging 0.98
R5299:Mical3 UTSW 6 120959512 missense possibly damaging 0.71
R5303:Mical3 UTSW 6 120959980 missense probably benign
R5368:Mical3 UTSW 6 120959473 missense probably damaging 1.00
R5955:Mical3 UTSW 6 121033750 missense probably damaging 0.99
R5970:Mical3 UTSW 6 120958271 nonsense probably null
R6000:Mical3 UTSW 6 121021320 missense probably benign 0.06
R6101:Mical3 UTSW 6 121033710 missense probably damaging 1.00
R6195:Mical3 UTSW 6 121016835 intron probably benign
R6210:Mical3 UTSW 6 121040517 unclassified probably null
R6225:Mical3 UTSW 6 120958723 missense probably damaging 0.98
R6260:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6349:Mical3 UTSW 6 120959525 missense probably benign
R6352:Mical3 UTSW 6 120952473 missense probably damaging 0.97
R6480:Mical3 UTSW 6 121034275 missense possibly damaging 0.76
R6704:Mical3 UTSW 6 121009800 intron probably benign
R6783:Mical3 UTSW 6 120958825 missense possibly damaging 0.85
R6925:Mical3 UTSW 6 120959390 missense probably benign 0.05
R6960:Mical3 UTSW 6 120958543 missense probably damaging 1.00
U24488:Mical3 UTSW 6 121001496 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTCCAAGGTCTTATGTGAGG -3'
(R):5'- GCCACAGAGTCTGATATGCTC -3'

Sequencing Primer
(F):5'- CTTATGTGAGGTAAGAAAGTCTGATG -3'
(R):5'- ACAGAGTCTGATATGCTCCTCTAC -3'
Posted On2018-03-15