Incidental Mutation 'R6258:Pcdhb12'
ID506512
Institutional Source Beutler Lab
Gene Symbol Pcdhb12
Ensembl Gene ENSMUSG00000043458
Gene Nameprotocadherin beta 12
SynonymsPcdh3, PcdhbL, Pcdhb5F
MMRRC Submission 044375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6258 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37435621-37438654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37436839 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 346 (V346A)
Ref Sequence ENSEMBL: ENSMUSP00000050357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055495] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000055495
AA Change: V346A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000050357
Gene: ENSMUSG00000043458
AA Change: V346A

DomainStartEndE-ValueType
CA 53 130 1.67e-1 SMART
CA 154 239 3.69e-23 SMART
CA 263 343 6.56e-29 SMART
CA 366 447 5.9e-22 SMART
CA 471 557 4.24e-23 SMART
CA 587 668 1.01e-11 SMART
Pfam:Cadherin_C_2 685 768 4.8e-26 PFAM
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193629
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,676,567 H339R probably benign Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
AU041133 A G 10: 82,151,158 E215G probably damaging Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Casr A G 16: 36,517,609 C60R probably damaging Het
Cdc7 A G 5: 106,969,227 K84E probably damaging Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Clcc1 G A 3: 108,673,308 V313I possibly damaging Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Egflam T A 15: 7,234,292 T726S probably damaging Het
Eml2 T G 7: 19,179,364 probably null Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Faiml T C 9: 99,232,460 I125M possibly damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Fbxw2 A T 2: 34,812,813 probably null Het
Fgd6 T A 10: 94,044,299 N338K probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm32742 T A 9: 51,157,562 I200F probably damaging Het
Gm35339 C A 15: 76,355,695 S277* probably null Het
Gm4924 T G 10: 82,377,473 probably benign Het
Gm8369 G A 19: 11,511,609 A87T possibly damaging Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Ighv5-8 A G 12: 113,654,991 T9A possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jakmip1 G T 5: 37,141,760 E775* probably null Het
Klhl40 T C 9: 121,777,960 F62S probably damaging Het
Krtcap3 A T 5: 31,252,228 R84W probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 T C 7: 66,710,748 probably null Het
Magi3 A G 3: 104,089,596 L211P probably damaging Het
Map2k5 T A 9: 63,217,365 I359F probably benign Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mef2c T A 13: 83,652,938 D252E probably damaging Het
Methig1 T C 15: 100,353,541 V111A possibly damaging Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Nf1 A T 11: 79,565,755 probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr485 T C 7: 108,158,974 N300D probably damaging Het
Pde7b T C 10: 20,440,800 D168G possibly damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Samm50 C G 15: 84,200,311 P150A probably damaging Het
Samm50 C A 15: 84,200,312 P150H probably damaging Het
Slc6a18 A T 13: 73,670,045 C284* probably null Het
Smc3 T A 19: 53,627,731 probably null Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
Sucnr1 T C 3: 60,086,357 L102P probably damaging Het
Tbc1d9 T C 8: 83,210,516 W76R probably damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ubr3 A G 2: 69,982,864 probably null Het
Ung A T 5: 114,137,300 Y250F probably benign Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zscan4-ps1 C A 7: 11,065,902 E353D probably benign Het
Other mutations in Pcdhb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pcdhb12 APN 18 37436982 missense probably benign 0.44
IGL01309:Pcdhb12 APN 18 37436154 missense probably damaging 1.00
IGL01834:Pcdhb12 APN 18 37437639 missense probably damaging 1.00
IGL01893:Pcdhb12 APN 18 37437210 missense probably benign 0.01
IGL02617:Pcdhb12 APN 18 37437046 missense probably benign 0.43
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0309:Pcdhb12 UTSW 18 37436121 missense probably benign
R0392:Pcdhb12 UTSW 18 37436958 missense possibly damaging 0.60
R0494:Pcdhb12 UTSW 18 37438095 missense probably benign
R0531:Pcdhb12 UTSW 18 37437318 missense probably damaging 1.00
R0571:Pcdhb12 UTSW 18 37437208 missense probably damaging 1.00
R0737:Pcdhb12 UTSW 18 37437709 missense probably damaging 1.00
R0882:Pcdhb12 UTSW 18 37437322 missense probably damaging 1.00
R1253:Pcdhb12 UTSW 18 37435821 missense possibly damaging 0.65
R1300:Pcdhb12 UTSW 18 37437397 missense possibly damaging 0.45
R1334:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1424:Pcdhb12 UTSW 18 37438079 missense probably benign
R1513:Pcdhb12 UTSW 18 37437058 missense probably damaging 1.00
R1654:Pcdhb12 UTSW 18 37436701 missense probably damaging 1.00
R1717:Pcdhb12 UTSW 18 37436788 missense probably damaging 1.00
R1753:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1774:Pcdhb12 UTSW 18 37436442 missense possibly damaging 0.52
R1893:Pcdhb12 UTSW 18 37437083 missense probably benign 0.24
R1901:Pcdhb12 UTSW 18 37437630 missense possibly damaging 0.67
R2114:Pcdhb12 UTSW 18 37436212 missense probably damaging 1.00
R2264:Pcdhb12 UTSW 18 37436805 missense probably damaging 0.99
R2915:Pcdhb12 UTSW 18 37437640 missense probably damaging 1.00
R3689:Pcdhb12 UTSW 18 37436074 missense probably benign 0.01
R3918:Pcdhb12 UTSW 18 37437048 missense probably benign
R4621:Pcdhb12 UTSW 18 37437160 missense probably benign
R4679:Pcdhb12 UTSW 18 37436949 missense probably damaging 1.00
R4709:Pcdhb12 UTSW 18 37437495 missense probably benign 0.08
R4904:Pcdhb12 UTSW 18 37437856 missense possibly damaging 0.80
R4953:Pcdhb12 UTSW 18 37436156 missense probably damaging 1.00
R5091:Pcdhb12 UTSW 18 37435854 nonsense probably null
R5130:Pcdhb12 UTSW 18 37435824 missense probably benign
R5204:Pcdhb12 UTSW 18 37436089 missense probably damaging 0.99
R5361:Pcdhb12 UTSW 18 37437046 missense probably damaging 1.00
R5417:Pcdhb12 UTSW 18 37436034 missense probably benign 0.00
R5979:Pcdhb12 UTSW 18 37437991 missense possibly damaging 0.94
R6117:Pcdhb12 UTSW 18 37435642 intron probably benign
R6260:Pcdhb12 UTSW 18 37436839 missense probably benign 0.00
R6270:Pcdhb12 UTSW 18 37436785 missense possibly damaging 0.68
R6623:Pcdhb12 UTSW 18 37437658 missense possibly damaging 0.54
R7288:Pcdhb12 UTSW 18 37436015 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCAAGGGGATGGATTATCTCAACC -3'
(R):5'- TCCCAGACAGTGATGGTGATG -3'

Sequencing Primer
(F):5'- AGGGGATGGATTATCTCAACCATTTG -3'
(R):5'- CCAGACAGTGATGGTGATGTTGTAC -3'
Posted On2018-03-15