Incidental Mutation 'R6260:Map4k5'
ID506642
Institutional Source Beutler Lab
Gene Symbol Map4k5
Ensembl Gene ENSMUSG00000034761
Gene Namemitogen-activated protein kinase kinase kinase kinase 5
SynonymsMAPKKKK5, GCKR, KHS, 4432415E19Rik
MMRRC Submission 044377-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6260 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location69803750-69893200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69831562 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 355 (R355L)
Ref Sequence ENSEMBL: ENSMUSP00000047812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049239] [ENSMUST00000110567] [ENSMUST00000110570] [ENSMUST00000171211]
Predicted Effect probably benign
Transcript: ENSMUST00000049239
AA Change: R355L

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047812
Gene: ENSMUSG00000034761
AA Change: R355L

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 4.57e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110567
AA Change: R336L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106196
Gene: ENSMUSG00000034761
AA Change: R336L

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 370 377 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
CNH 493 808 3.98e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110570
AA Change: R355L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106199
Gene: ENSMUSG00000034761
AA Change: R355L

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 3.98e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153712
Predicted Effect probably benign
Transcript: ENSMUST00000171211
AA Change: R288L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126006
Gene: ENSMUSG00000034761
AA Change: R288L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 208 2e-32 PFAM
Pfam:Pkinase 1 210 6.2e-52 PFAM
low complexity region 322 329 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
CNH 445 760 4.57e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188608
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and phenotypically normal but show impaired canonical and noncanonical Wnt signaling in progenitor B lymphocytes. Mice homozygous for a gene trap exhibit hypoalgesia, increased serum IgG1 and an increased percentage of peripheral blood CD4+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,008,987 N1514K probably damaging Het
Abcb4 G T 5: 8,934,219 G650* probably null Het
Acsbg1 T A 9: 54,628,467 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
Ank2 C T 3: 126,943,557 V2806I probably benign Het
Atxn10 A T 15: 85,462,411 I457F probably benign Het
Cad G T 5: 31,066,800 M800I probably null Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Ccz1 A G 5: 144,004,041 probably null Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Cfap52 A T 11: 67,938,954 C330S possibly damaging Het
Clec16a C T 16: 10,694,848 probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddhd2 A G 8: 25,752,117 F244L probably benign Het
Ddn A G 15: 98,805,854 V519A possibly damaging Het
Dip2b G T 15: 100,162,702 V253L probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Foxd4 A G 19: 24,899,604 S411P probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Galntl6 T A 8: 57,884,481 D135V probably damaging Het
Gm1043 G C 5: 37,174,472 G832A probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm21103 C T 14: 6,303,847 E68K probably damaging Het
Gm340 A T 19: 41,582,370 S1C probably null Het
Gm340 G T 19: 41,582,371 S1I possibly damaging Het
Gpam A G 19: 55,083,406 V301A probably benign Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jak3 C A 8: 71,679,310 Q177K probably benign Het
Kcnu1 G A 8: 25,851,891 R88H probably damaging Het
Kng1 A T 16: 23,058,621 I60F possibly damaging Het
Krt77 A T 15: 101,864,372 Y257* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mefv C T 16: 3,713,034 R498H probably benign Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Mtcl1 T A 17: 66,343,541 Q1340L probably damaging Het
Nfic A T 10: 81,420,517 C126* probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr694 A T 7: 106,688,872 N286K probably damaging Het
Olfr808 C A 10: 129,767,520 T8K probably benign Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Plxnb2 A T 15: 89,165,291 I575N probably benign Het
Pnmal2 T G 7: 16,946,233 W381G probably benign Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rwdd2b C A 16: 87,434,468 G266V probably damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
St8sia2 T A 7: 73,976,693 R42S possibly damaging Het
Syt9 G T 7: 107,436,510 V245F possibly damaging Het
Tbpl2 T A 2: 24,094,886 N82I possibly damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Timm13 A C 10: 80,900,301 probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ttc27 T A 17: 74,858,091 V764D probably damaging Het
Ttc39d C A 17: 80,216,647 S245* probably null Het
Ttc41 A G 10: 86,731,159 E563G probably benign Het
Ttc41 A T 10: 86,733,707 T650S probably benign Het
U2surp A C 9: 95,476,157 L723R probably damaging Het
Ubqln3 G A 7: 104,142,317 Q189* probably null Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Vmn2r79 T A 7: 87,037,157 M582K probably benign Het
Zfp518a A G 19: 40,914,123 D832G probably benign Het
Zfyve28 T C 5: 34,198,872 N762D probably damaging Het
Other mutations in Map4k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Map4k5 APN 12 69845732 missense probably damaging 1.00
IGL01013:Map4k5 APN 12 69827526 splice site probably benign
IGL01309:Map4k5 APN 12 69841963 missense probably benign 0.00
IGL02314:Map4k5 APN 12 69818439 missense probably benign 0.05
IGL02612:Map4k5 APN 12 69849584 missense possibly damaging 0.63
IGL02620:Map4k5 APN 12 69892702 missense probably benign 0.05
IGL02749:Map4k5 APN 12 69815806 missense probably benign 0.25
R0662:Map4k5 UTSW 12 69813153 missense probably damaging 1.00
R0731:Map4k5 UTSW 12 69874264 intron probably benign
R0828:Map4k5 UTSW 12 69805326 missense probably damaging 0.98
R1026:Map4k5 UTSW 12 69874288 missense possibly damaging 0.95
R1178:Map4k5 UTSW 12 69816378 missense probably damaging 0.99
R1464:Map4k5 UTSW 12 69805350 missense possibly damaging 0.89
R1464:Map4k5 UTSW 12 69805350 missense possibly damaging 0.89
R1615:Map4k5 UTSW 12 69844413 missense probably damaging 1.00
R1632:Map4k5 UTSW 12 69828047 missense probably benign
R1652:Map4k5 UTSW 12 69830427 critical splice donor site probably null
R1677:Map4k5 UTSW 12 69805308 missense probably benign 0.01
R1835:Map4k5 UTSW 12 69824662 missense probably damaging 1.00
R1895:Map4k5 UTSW 12 69845755 missense probably damaging 1.00
R1946:Map4k5 UTSW 12 69845755 missense probably damaging 1.00
R1968:Map4k5 UTSW 12 69818492 missense probably damaging 0.99
R1971:Map4k5 UTSW 12 69826328 missense possibly damaging 0.81
R1987:Map4k5 UTSW 12 69842912 missense probably damaging 1.00
R2070:Map4k5 UTSW 12 69816337 missense probably damaging 0.99
R2471:Map4k5 UTSW 12 69856846 missense probably benign 0.30
R3417:Map4k5 UTSW 12 69809264 missense probably damaging 1.00
R4133:Map4k5 UTSW 12 69845723 missense probably damaging 1.00
R4331:Map4k5 UTSW 12 69827374 missense probably benign 0.00
R4388:Map4k5 UTSW 12 69845809 missense probably damaging 1.00
R4685:Map4k5 UTSW 12 69811366 missense probably benign
R4760:Map4k5 UTSW 12 69824598 missense possibly damaging 0.49
R4822:Map4k5 UTSW 12 69841984 nonsense probably null
R4863:Map4k5 UTSW 12 69818438 missense probably benign 0.04
R4971:Map4k5 UTSW 12 69852719 missense possibly damaging 0.60
R5038:Map4k5 UTSW 12 69824614 missense probably damaging 1.00
R5055:Map4k5 UTSW 12 69831558 missense probably benign
R5248:Map4k5 UTSW 12 69841981 missense probably benign 0.36
R5428:Map4k5 UTSW 12 69838013 missense possibly damaging 0.94
R5697:Map4k5 UTSW 12 69830436 missense probably benign
R5757:Map4k5 UTSW 12 69824655 missense probably damaging 1.00
R5955:Map4k5 UTSW 12 69844390 missense probably damaging 1.00
R6258:Map4k5 UTSW 12 69831562 missense probably benign 0.06
R6259:Map4k5 UTSW 12 69852740 missense probably damaging 0.97
R6796:Map4k5 UTSW 12 69818025 missense probably benign 0.01
R6979:Map4k5 UTSW 12 69822848 missense probably damaging 1.00
R7164:Map4k5 UTSW 12 69830436 missense probably benign
R7184:Map4k5 UTSW 12 69874321 missense probably benign 0.00
X0062:Map4k5 UTSW 12 69824607 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGAGTGGGTCAAACGACAC -3'
(R):5'- CCTTTATCTGGGTGAGTAGAAAGG -3'

Sequencing Primer
(F):5'- CAGCCCGTAGTACCATCAAAGTG -3'
(R):5'- GGAATAAGAGAGTTTTTCTTCTCTGC -3'
Posted On2018-03-15