Incidental Mutation 'R6260:Plxnb2'
ID506648
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
MMRRC Submission 044377-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6260 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89165291 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 575 (I575N)
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably benign
Transcript: ENSMUST00000060808
AA Change: I575N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: I575N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109331
AA Change: I575N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: I575N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197760
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,008,987 N1514K probably damaging Het
Abcb4 G T 5: 8,934,219 G650* probably null Het
Acsbg1 T A 9: 54,628,467 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
Ank2 C T 3: 126,943,557 V2806I probably benign Het
Atxn10 A T 15: 85,462,411 I457F probably benign Het
Cad G T 5: 31,066,800 M800I probably null Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Ccz1 A G 5: 144,004,041 probably null Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Cfap52 A T 11: 67,938,954 C330S possibly damaging Het
Clec16a C T 16: 10,694,848 probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddhd2 A G 8: 25,752,117 F244L probably benign Het
Ddn A G 15: 98,805,854 V519A possibly damaging Het
Dip2b G T 15: 100,162,702 V253L probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Foxd4 A G 19: 24,899,604 S411P probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Galntl6 T A 8: 57,884,481 D135V probably damaging Het
Gm1043 G C 5: 37,174,472 G832A probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm21103 C T 14: 6,303,847 E68K probably damaging Het
Gm340 A T 19: 41,582,370 S1C probably null Het
Gm340 G T 19: 41,582,371 S1I possibly damaging Het
Gpam A G 19: 55,083,406 V301A probably benign Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jak3 C A 8: 71,679,310 Q177K probably benign Het
Kcnu1 G A 8: 25,851,891 R88H probably damaging Het
Kng1 A T 16: 23,058,621 I60F possibly damaging Het
Krt77 A T 15: 101,864,372 Y257* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mefv C T 16: 3,713,034 R498H probably benign Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Mtcl1 T A 17: 66,343,541 Q1340L probably damaging Het
Nfic A T 10: 81,420,517 C126* probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr694 A T 7: 106,688,872 N286K probably damaging Het
Olfr808 C A 10: 129,767,520 T8K probably benign Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Pnmal2 T G 7: 16,946,233 W381G probably benign Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rwdd2b C A 16: 87,434,468 G266V probably damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
St8sia2 T A 7: 73,976,693 R42S possibly damaging Het
Syt9 G T 7: 107,436,510 V245F possibly damaging Het
Tbpl2 T A 2: 24,094,886 N82I possibly damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Timm13 A C 10: 80,900,301 probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ttc27 T A 17: 74,858,091 V764D probably damaging Het
Ttc39d C A 17: 80,216,647 S245* probably null Het
Ttc41 A G 10: 86,731,159 E563G probably benign Het
Ttc41 A T 10: 86,733,707 T650S probably benign Het
U2surp A C 9: 95,476,157 L723R probably damaging Het
Ubqln3 G A 7: 104,142,317 Q189* probably null Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Vmn2r79 T A 7: 87,037,157 M582K probably benign Het
Zfp518a A G 19: 40,914,123 D832G probably benign Het
Zfyve28 T C 5: 34,198,872 N762D probably damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCGGTCTCCTCAGAACAGAAC -3'
(R):5'- CCAAGACGGAGCAGTGTAGTAC -3'

Sequencing Primer
(F):5'- GGTCTCCTCAGAACAGAACTCAGTC -3'
(R):5'- TGTAGTACTAGGATCAGAGGTCATC -3'
Posted On2018-03-15