Incidental Mutation 'R6261:Cnot1'
ID506702
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6261 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95741921 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1432 (S1432P)
Ref Sequence ENSEMBL: ENSMUSP00000148735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect probably benign
Transcript: ENSMUST00000068452
AA Change: S1427P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: S1427P

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083155
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: S1432P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: S1432P

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: S1425P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000211973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212340
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Predicted Effect probably benign
Transcript: ENSMUST00000213006
AA Change: S1432P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 T C 2: 164,795,059 D257G probably damaging Het
Adamtsl1 T C 4: 86,336,878 V736A probably benign Het
Anln A G 9: 22,364,046 L521S probably damaging Het
Arfgap2 T G 2: 91,270,282 S311A probably benign Het
Brdt A T 5: 107,348,503 E160D probably benign Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Cd59a G C 2: 104,104,205 G6A probably damaging Het
Cd5l C T 3: 87,368,608 P295L probably benign Het
Cnot8 T A 11: 58,114,051 I192N probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Cuta A G 17: 26,939,327 L11P possibly damaging Het
Cyp2c39 G A 19: 39,568,019 R433H probably damaging Het
Cyp4a12b T A 4: 115,414,543 Y150* probably null Het
Dcaf15 G A 8: 84,099,105 A291V probably benign Het
Dcstamp A T 15: 39,754,735 H180L possibly damaging Het
Egfr A G 11: 16,889,964 I659M probably benign Het
Fzd8 A G 18: 9,214,598 E560G possibly damaging Het
Gm28710 T C 5: 16,812,185 noncoding transcript Het
Gm5111 A T 6: 48,589,592 probably benign Het
Gm7945 T C 14: 41,382,823 T214A unknown Het
Gpi1 T C 7: 34,220,745 T168A possibly damaging Het
Gys2 T C 6: 142,459,408 I218V probably benign Het
Gzmf T A 14: 56,206,492 I74L probably benign Het
Hacl1 G A 14: 31,635,771 A70V probably damaging Het
Herc2 T A 7: 56,197,072 L3590* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals G T 17: 24,881,365 V477F possibly damaging Het
Igkv8-28 A T 6: 70,143,890 V23E probably benign Het
Isg20l2 T A 3: 87,932,088 V202E probably damaging Het
Jakmip2 A G 18: 43,575,534 I288T probably benign Het
Kansl3 A G 1: 36,365,605 V88A probably benign Het
Kcna3 A G 3: 107,037,950 T510A possibly damaging Het
Map2k5 G T 9: 63,338,098 L140I probably benign Het
Map3k19 A G 1: 127,822,599 I1005T possibly damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Ms4a14 T A 19: 11,304,020 E391D probably benign Het
Mtrf1l A G 10: 5,815,550 probably null Het
Myom1 A G 17: 71,126,137 N1591S probably damaging Het
Nos1 G A 5: 117,936,570 V1060M probably benign Het
Nsun5 C T 5: 135,371,531 T142M probably damaging Het
Odc1 A G 12: 17,550,654 E430G probably benign Het
Olfr957 C A 9: 39,510,809 V304F probably benign Het
P2ry12 T C 3: 59,217,907 I116V probably null Het
Patl1 T A 19: 11,920,331 V94E probably damaging Het
Plin3 A T 17: 56,281,488 Y255* probably null Het
Pou6f1 T C 15: 100,579,946 T439A probably damaging Het
Prdm13 T C 4: 21,678,366 K708R probably damaging Het
Prr14l A G 5: 32,829,404 S916P possibly damaging Het
Rab34 T A 11: 78,191,202 probably null Het
Rps7 A G 12: 28,635,594 S21P possibly damaging Het
Scn9a A T 2: 66,483,896 L1815Q probably damaging Het
Sesn3 A G 9: 14,321,163 Y244C probably benign Het
Slc15a2 A G 16: 36,761,611 F284L probably benign Het
Slc25a44 C T 3: 88,420,911 G72D probably damaging Het
Slco6d1 A G 1: 98,499,863 T640A probably benign Het
Sspo A T 6: 48,462,191 E1591V possibly damaging Het
Tbata C A 10: 61,175,865 T60K possibly damaging Het
Tbc1d2 T A 4: 46,637,692 T185S possibly damaging Het
Tmem56 T A 3: 121,235,059 I60F possibly damaging Het
Tmem87a A G 2: 120,404,021 S14P possibly damaging Het
Tnnt2 C A 1: 135,850,554 probably null Het
Trex1 A G 9: 109,058,641 V94A probably benign Het
Ubtfl1 A C 9: 18,409,296 D40A possibly damaging Het
Zc3hav1 A T 6: 38,333,000 Y296N probably benign Het
Zfp521 T A 18: 13,844,627 N910Y probably damaging Het
Zfp53 A G 17: 21,508,713 E336G possibly damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAGTGCTAAGGAGTTTGCC -3'
(R):5'- CAGATGTGACTTGTGCCTTG -3'

Sequencing Primer
(F):5'- CAGTGCTAAGGAGTTTGCCCTAAC -3'
(R):5'- CAGATGTGACTTGTGCCTTGTTTCC -3'
Posted On2018-03-15