Incidental Mutation 'R6262:Calr4'
ID506744
Institutional Source Beutler Lab
Gene Symbol Calr4
Ensembl Gene ENSMUSG00000028558
Gene Namecalreticulin 4
Synonyms4933403L16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location109234485-109254571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109251367 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 213 (N213I)
Ref Sequence ENSEMBL: ENSMUSP00000102242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030285] [ENSMUST00000106628] [ENSMUST00000106629] [ENSMUST00000106631]
Predicted Effect probably damaging
Transcript: ENSMUST00000030285
AA Change: N320I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030285
Gene: ENSMUSG00000028558
AA Change: N320I

DomainStartEndE-ValueType
Pfam:Calreticulin 11 246 7e-61 PFAM
Pfam:Calreticulin 243 318 1.7e-21 PFAM
coiled coil region 336 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106628
AA Change: N213I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102239
Gene: ENSMUSG00000028558
AA Change: N213I

DomainStartEndE-ValueType
Pfam:Calreticulin 1 211 6.4e-77 PFAM
coiled coil region 229 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106629
AA Change: N213I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102240
Gene: ENSMUSG00000028558
AA Change: N213I

DomainStartEndE-ValueType
Pfam:Calreticulin 1 211 6.4e-77 PFAM
coiled coil region 229 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106631
AA Change: N213I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102242
Gene: ENSMUSG00000028558
AA Change: N213I

DomainStartEndE-ValueType
Pfam:Calreticulin 1 211 6.4e-77 PFAM
coiled coil region 229 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141555
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Calr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Calr4 APN 4 109244115 missense probably damaging 1.00
IGL01392:Calr4 APN 4 109253874 missense probably benign 0.41
IGL01676:Calr4 APN 4 109244250 missense probably damaging 0.99
IGL02587:Calr4 APN 4 109238937 missense possibly damaging 0.76
PIT4576001:Calr4 UTSW 4 109235856 missense possibly damaging 0.82
R0525:Calr4 UTSW 4 109242264 splice site probably benign
R1444:Calr4 UTSW 4 109246241 missense possibly damaging 0.76
R1899:Calr4 UTSW 4 109246293 critical splice donor site probably null
R4561:Calr4 UTSW 4 109246182 missense probably damaging 0.97
R5001:Calr4 UTSW 4 109238982 critical splice donor site probably null
R5014:Calr4 UTSW 4 109235797 nonsense probably null
R5088:Calr4 UTSW 4 109244662 intron probably benign
R5267:Calr4 UTSW 4 109244076 missense probably damaging 1.00
R6175:Calr4 UTSW 4 109244245 missense probably benign 0.03
R6795:Calr4 UTSW 4 109244788 missense probably damaging 1.00
R7099:Calr4 UTSW 4 109242229 missense probably benign 0.01
R7202:Calr4 UTSW 4 109244057 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATGACTTCATAGCATTCTTAAAGAAG -3'
(R):5'- GATGTTCCGTGAAAGTGAGTTCTC -3'

Sequencing Primer
(F):5'- GTATGTGCATACACCCATGGC -3'
(R):5'- TCTGTCTCTAAAGCCCAAGTGATCAG -3'
Posted On2018-03-15