Incidental Mutation 'R6262:Vwde'
ID506751
Institutional Source Beutler Lab
Gene Symbol Vwde
Ensembl Gene ENSMUSG00000079679
Gene Namevon Willebrand factor D and EGF domains
SynonymsLOC232585
MMRRC Submission
Accession Numbers

Genbank: NM_001013757; MGI: 2685313 

Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location13156299-13224965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13205021 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 287 (S287N)
Ref Sequence ENSEMBL: ENSMUSP00000058110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054530] [ENSMUST00000203074]
Predicted Effect probably damaging
Transcript: ENSMUST00000054530
AA Change: S287N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058110
Gene: ENSMUSG00000079679
AA Change: S287N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:ZP 58 163 1e-5 BLAST
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 1.51e-4 SMART
low complexity region 638 651 N/A INTRINSIC
Blast:EGF_like 890 918 2e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000203074
AA Change: S287N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145311
Gene: ENSMUSG00000079679
AA Change: S287N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 7.4e-7 SMART
low complexity region 638 651 N/A INTRINSIC
EGF_like 890 918 1.5e-1 SMART
EGF 1166 1217 8.5e-6 SMART
EGF_like 1182 1233 2.7e-2 SMART
EGF 1222 1254 9.7e-7 SMART
EGF_CA 1256 1295 5.3e-12 SMART
EGF 1446 1483 5e-2 SMART
EGF 1485 1514 3.8e-3 SMART
EGF 1517 1546 3.6e-3 SMART
EGF 1549 1578 8e-7 SMART
EGF 1581 1610 3.4e-3 SMART
EGF 1613 1642 1.5e-3 SMART
EGF 1645 1674 1.1e-5 SMART
EGF 1677 1706 2.5e-4 SMART
EGF 1709 1738 2.5e-3 SMART
EGF 1741 1770 1.8e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204339
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Vwde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Vwde APN 6 13187412 missense probably benign 0.00
IGL01391:Vwde APN 6 13190527 missense probably benign 0.07
IGL01432:Vwde APN 6 13193240 missense probably benign 0.18
IGL01611:Vwde APN 6 13219978 missense probably damaging 1.00
IGL01835:Vwde APN 6 13186824 missense probably benign 0.43
IGL01993:Vwde APN 6 13219978 missense possibly damaging 0.89
IGL01997:Vwde APN 6 13215706 missense probably damaging 1.00
IGL02390:Vwde APN 6 13190685 missense probably damaging 1.00
IGL02612:Vwde APN 6 13187149 missense probably damaging 1.00
IGL02723:Vwde APN 6 13205760 missense probably damaging 0.99
IGL02731:Vwde APN 6 13192614 missense probably damaging 1.00
IGL02869:Vwde APN 6 13187137 missense probably damaging 1.00
IGL02981:Vwde APN 6 13193113 missense possibly damaging 0.84
IGL03031:Vwde APN 6 13208382 missense probably benign 0.10
IGL03180:Vwde APN 6 13205765 missense probably damaging 1.00
IGL03182:Vwde APN 6 13187139 missense probably damaging 1.00
C9142:Vwde UTSW 6 13168054 splice site probably benign
R0089:Vwde UTSW 6 13220005 missense probably damaging 1.00
R0244:Vwde UTSW 6 13193126 missense probably benign 0.16
R0355:Vwde UTSW 6 13187807 splice site probably benign
R0455:Vwde UTSW 6 13187529 missense probably benign 0.03
R0465:Vwde UTSW 6 13215806 splice site probably benign
R0946:Vwde UTSW 6 13187875 missense probably damaging 1.00
R1087:Vwde UTSW 6 13186804 missense probably damaging 1.00
R1236:Vwde UTSW 6 13187153 nonsense probably null
R1738:Vwde UTSW 6 13190724 missense probably damaging 1.00
R1891:Vwde UTSW 6 13187455 missense probably damaging 0.98
R2014:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2015:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2303:Vwde UTSW 6 13215807 splice site probably benign
R3439:Vwde UTSW 6 13208375 missense probably damaging 0.98
R3688:Vwde UTSW 6 13186892 missense probably damaging 0.96
R4457:Vwde UTSW 6 13196101 missense probably damaging 1.00
R4755:Vwde UTSW 6 13205852 missense possibly damaging 0.94
R4849:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4850:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4851:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4853:Vwde UTSW 6 13215640 missense probably damaging 1.00
R4951:Vwde UTSW 6 13187139 missense probably damaging 1.00
R5023:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5057:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5060:Vwde UTSW 6 13208324 splice site probably null
R5126:Vwde UTSW 6 13187260 missense probably benign 0.04
R5154:Vwde UTSW 6 13215758 missense probably benign 0.01
R5277:Vwde UTSW 6 13186996 missense probably benign 0.03
R5432:Vwde UTSW 6 13190592 missense probably damaging 1.00
R5436:Vwde UTSW 6 13190628 missense probably damaging 1.00
R5472:Vwde UTSW 6 13193118 missense probably benign 0.00
R5518:Vwde UTSW 6 13186938 missense probably benign 0.00
R5791:Vwde UTSW 6 13195986 nonsense probably null
R6045:Vwde UTSW 6 13219936 missense probably damaging 1.00
R6482:Vwde UTSW 6 13205844 missense probably damaging 1.00
R6500:Vwde UTSW 6 13208405 splice site probably null
R6562:Vwde UTSW 6 13193123 missense possibly damaging 0.84
R6905:Vwde UTSW 6 13205927 missense probably damaging 1.00
R7021:Vwde UTSW 6 13186906 missense probably damaging 1.00
R7103:Vwde UTSW 6 13215800 missense probably benign 0.03
R7356:Vwde UTSW 6 13192642 missense probably damaging 0.96
R7434:Vwde UTSW 6 13187640 missense probably benign 0.00
R7492:Vwde UTSW 6 13204981 missense not run
Predicted Primers PCR Primer
(F):5'- AGTTGGCCATCATTGGGAAGAG -3'
(R):5'- CCATGTGTGCATTGGATGTC -3'

Sequencing Primer
(F):5'- CAAACTTTATATGCCTCAGTTCGGGG -3'
(R):5'- GGGTATTAGATCCCCCAAATCTGG -3'
Posted On2018-03-15