Incidental Mutation 'R6262:Zfp667'
ID506757
Institutional Source Beutler Lab
Gene Symbol Zfp667
Ensembl Gene ENSMUSG00000054893
Gene Namezinc finger protein 667
SynonymsA830025F02Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001024928

Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location6286579-6307883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6304974 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 214 (T214A)
Ref Sequence ENSEMBL: ENSMUSP00000128658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086327] [ENSMUST00000108562] [ENSMUST00000153840] [ENSMUST00000170776]
Predicted Effect probably benign
Transcript: ENSMUST00000086327
AA Change: T214A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000083507
Gene: ENSMUSG00000054893
AA Change: T214A

DomainStartEndE-ValueType
KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108562
AA Change: T214A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104202
Gene: ENSMUSG00000054893
AA Change: T214A

DomainStartEndE-ValueType
KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153840
Predicted Effect probably benign
Transcript: ENSMUST00000170776
AA Change: T214A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128658
Gene: ENSMUSG00000054893
AA Change: T214A

DomainStartEndE-ValueType
KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Other mutations in Zfp667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp667 APN 7 6305397 missense possibly damaging 0.53
IGL01325:Zfp667 APN 7 6290546 missense probably damaging 1.00
IGL01386:Zfp667 APN 7 6304870 missense probably benign 0.00
IGL01960:Zfp667 APN 7 6305337 missense probably benign 0.00
IGL03394:Zfp667 APN 7 6289439 critical splice donor site probably null
B5639:Zfp667 UTSW 7 6290545 missense probably damaging 1.00
R0458:Zfp667 UTSW 7 6304845 missense probably benign 0.40
R0845:Zfp667 UTSW 7 6306092 missense possibly damaging 0.85
R1768:Zfp667 UTSW 7 6305067 missense possibly damaging 0.53
R1953:Zfp667 UTSW 7 6305088 missense probably benign 0.04
R2023:Zfp667 UTSW 7 6305417 missense possibly damaging 0.85
R3159:Zfp667 UTSW 7 6306000 missense probably damaging 1.00
R4080:Zfp667 UTSW 7 6305106 missense possibly damaging 0.71
R4476:Zfp667 UTSW 7 6304599 missense possibly damaging 0.53
R4584:Zfp667 UTSW 7 6290625 missense possibly damaging 0.84
R4783:Zfp667 UTSW 7 6305685 missense possibly damaging 0.83
R5037:Zfp667 UTSW 7 6305950 missense possibly damaging 0.71
R5300:Zfp667 UTSW 7 6304636 missense probably benign
R5311:Zfp667 UTSW 7 6305716 missense probably benign 0.10
R5312:Zfp667 UTSW 7 6305467 missense probably benign
R5340:Zfp667 UTSW 7 6305253 missense possibly damaging 0.53
R7386:Zfp667 UTSW 7 6305950 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCCAAGAAGGAACATTCAGGC -3'
(R):5'- TTCTGTTGTGACTCCTCTTATGAAG -3'

Sequencing Primer
(F):5'- AGTGTAATCTTTGTGGGAAAACC -3'
(R):5'- GTGACTCCTCTTATGAAGTAAAAGGG -3'
Posted On2018-03-15