Incidental Mutation 'R6262:Art5'
ID506760
Institutional Source Beutler Lab
Gene Symbol Art5
Ensembl Gene ENSMUSG00000070424
Gene NameADP-ribosyltransferase 5
SynonymsYac-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102096879-102109489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102098131 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 147 (G147D)
Ref Sequence ENSEMBL: ENSMUSP00000102550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033300] [ENSMUST00000084843] [ENSMUST00000094128] [ENSMUST00000106934] [ENSMUST00000106935] [ENSMUST00000106937] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104] [ENSMUST00000209809] [ENSMUST00000210211]
Predicted Effect probably benign
Transcript: ENSMUST00000033300
SMART Domains Protein: ENSMUSP00000033300
Gene: ENSMUSG00000030996

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ART 39 269 2e-99 PFAM
low complexity region 288 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084843
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094128
AA Change: G147D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424
AA Change: G147D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106934
SMART Domains Protein: ENSMUSP00000102547
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 117 3.7e-29 PFAM
Pfam:ART 114 157 6.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106935
SMART Domains Protein: ENSMUSP00000102548
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 146 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106937
AA Change: G147D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102550
Gene: ENSMUSG00000070424
AA Change: G147D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 1.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123372
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000124189
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209809
Predicted Effect probably benign
Transcript: ENSMUST00000210211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211553
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Art5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Art5 APN 7 102097916 missense probably null
IGL02507:Art5 APN 7 102099492 start codon destroyed probably null 0.83
IGL03143:Art5 APN 7 102097897 missense probably damaging 1.00
R0632:Art5 UTSW 7 102097957 missense probably damaging 1.00
R1215:Art5 UTSW 7 102097909 missense probably damaging 0.99
R2151:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R2152:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R2153:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R4533:Art5 UTSW 7 102098338 missense probably benign
R4719:Art5 UTSW 7 102098494 unclassified probably null
R5042:Art5 UTSW 7 102099465 missense probably damaging 0.99
R5098:Art5 UTSW 7 102097970 missense probably damaging 0.98
R5341:Art5 UTSW 7 102098099 missense probably benign 0.01
R6037:Art5 UTSW 7 102098384 missense probably benign 0.01
R6037:Art5 UTSW 7 102098384 missense probably benign 0.01
R6850:Art5 UTSW 7 102098095 missense possibly damaging 0.60
R7186:Art5 UTSW 7 102097329 missense probably benign
R7270:Art5 UTSW 7 102097873 missense probably damaging 1.00
R7381:Art5 UTSW 7 102098170 missense probably damaging 1.00
X0061:Art5 UTSW 7 102098380 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CTTAGATTGAAGAAGGTGGCATTC -3'
(R):5'- ATCCTGGGAAGCAGCACAAG -3'

Sequencing Primer
(F):5'- TGGCATTCCCAAACCTGCG -3'
(R):5'- GGCGTCACAAGCTCACTC -3'
Posted On2018-03-15