Incidental Mutation 'R6262:Pfkl'
ID506769
Institutional Source Beutler Lab
Gene Symbol Pfkl
Ensembl Gene ENSMUSG00000020277
Gene Namephosphofructokinase, liver, B-type
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77986947-78010083 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 77988673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020522] [ENSMUST00000105397] [ENSMUST00000105398]
Predicted Effect probably null
Transcript: ENSMUST00000020522
SMART Domains Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277

DomainStartEndE-ValueType
Pfam:PFK 17 324 4.7e-109 PFAM
Pfam:PFK 401 686 1.9e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105397
SMART Domains Protein: ENSMUSP00000101036
Gene: ENSMUSG00000020284

DomainStartEndE-ValueType
LRRcap 104 122 3.42e-2 SMART
low complexity region 178 191 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105398
SMART Domains Protein: ENSMUSP00000101037
Gene: ENSMUSG00000020284

DomainStartEndE-ValueType
LRRcap 104 122 3.42e-2 SMART
low complexity region 178 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149271
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Pfkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Pfkl APN 10 77991395 missense probably benign
IGL01759:Pfkl APN 10 78000731 missense probably damaging 1.00
IGL02697:Pfkl APN 10 77999918 missense probably benign 0.09
IGL02870:Pfkl APN 10 78000839 nonsense probably null
IGL02942:Pfkl APN 10 78000133 critical splice donor site probably null
IGL02972:Pfkl APN 10 77988274 missense probably benign 0.00
IGL03342:Pfkl APN 10 78005475 missense possibly damaging 0.95
ANU23:Pfkl UTSW 10 77991395 missense probably benign
R0226:Pfkl UTSW 10 77992534 missense probably benign 0.00
R0743:Pfkl UTSW 10 77995243 critical splice donor site probably null
R0899:Pfkl UTSW 10 78005439 critical splice donor site probably null
R0926:Pfkl UTSW 10 78000689 missense probably damaging 1.00
R1264:Pfkl UTSW 10 77993416 missense possibly damaging 0.46
R1782:Pfkl UTSW 10 77988720 missense probably benign 0.00
R1918:Pfkl UTSW 10 78001426 missense probably damaging 1.00
R3743:Pfkl UTSW 10 77996345 missense probably damaging 1.00
R4559:Pfkl UTSW 10 77988883 missense probably benign 0.00
R4804:Pfkl UTSW 10 77991394 missense probably benign
R4823:Pfkl UTSW 10 77997594 missense probably damaging 1.00
R4906:Pfkl UTSW 10 77988310 missense probably damaging 1.00
R5082:Pfkl UTSW 10 77996408 missense probably damaging 1.00
R5216:Pfkl UTSW 10 78009670 missense probably damaging 0.99
R5380:Pfkl UTSW 10 77997589 missense possibly damaging 0.86
R5816:Pfkl UTSW 10 78002022 missense possibly damaging 0.75
R5840:Pfkl UTSW 10 77988724 missense probably benign
R5888:Pfkl UTSW 10 77991370 missense possibly damaging 0.68
R6143:Pfkl UTSW 10 77989613 missense probably damaging 0.96
R6152:Pfkl UTSW 10 77990151 missense probably benign 0.00
R6251:Pfkl UTSW 10 77989565 critical splice donor site probably null
R6382:Pfkl UTSW 10 77999837 missense probably damaging 0.98
R6407:Pfkl UTSW 10 77988673 critical splice donor site probably null
R6547:Pfkl UTSW 10 77995354 missense probably benign
R6704:Pfkl UTSW 10 77996366 missense probably damaging 1.00
R6996:Pfkl UTSW 10 77997589 missense probably damaging 1.00
R7116:Pfkl UTSW 10 78001415 missense probably benign
R7154:Pfkl UTSW 10 78001455 missense probably benign 0.41
R7183:Pfkl UTSW 10 78002082 nonsense probably null
R7248:Pfkl UTSW 10 77989589 missense probably damaging 1.00
R7252:Pfkl UTSW 10 77993429 missense probably damaging 1.00
R7278:Pfkl UTSW 10 77992023 missense probably damaging 0.99
X0026:Pfkl UTSW 10 77989643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAGTACTTCTGAGGTAGACTC -3'
(R):5'- TGGGTGTCTGAGAAGCTACG -3'

Sequencing Primer
(F):5'- TAGACTCAGATGCAAGAGTCAC -3'
(R):5'- AAGCTACGTGATGTCTACCG -3'
Posted On2018-03-15