Incidental Mutation 'R6262:Inpp5j'
ID506772
Institutional Source Beutler Lab
Gene Symbol Inpp5j
Ensembl Gene ENSMUSG00000034570
Gene Nameinositol polyphosphate 5-phosphatase J
SynonymsPipp, Pib5pa
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R6262 (G1)
Quality Score224.009
Status Validated
Chromosome11
Chromosomal Location3494375-3504821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3502615 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 212 (S212P)
Ref Sequence ENSEMBL: ENSMUSP00000139302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044507] [ENSMUST00000044682] [ENSMUST00000110018] [ENSMUST00000110019] [ENSMUST00000154756] [ENSMUST00000183684]
Predicted Effect probably benign
Transcript: ENSMUST00000044507
AA Change: S212P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000046625
Gene: ENSMUSG00000034570
AA Change: S212P

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 840 862 N/A INTRINSIC
low complexity region 868 887 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 992 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044682
SMART Domains Protein: ENSMUSP00000041571
Gene: ENSMUSG00000034579

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 139 259 1.58e-2 SMART
low complexity region 305 324 N/A INTRINSIC
Pfam:Phospholip_A2_2 343 431 4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110018
SMART Domains Protein: ENSMUSP00000105645
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110019
SMART Domains Protein: ENSMUSP00000105646
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148939
Predicted Effect probably benign
Transcript: ENSMUST00000154756
AA Change: S212P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139302
Gene: ENSMUSG00000034570
AA Change: S212P

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 870 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183684
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile, and show normal mammary gland development and no spontaneous mammary tumors. However, in an oncogene-driven breast cancer mouse model, mice show increased mammary hyperplasia and tumor growth paradoxically associated with reduced lung metastases. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Inpp5j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Inpp5j APN 11 3500009 splice site probably benign
IGL00435:Inpp5j APN 11 3502255 missense probably benign 0.00
IGL00509:Inpp5j APN 11 3501595 missense possibly damaging 0.94
IGL00916:Inpp5j APN 11 3502389 missense probably damaging 1.00
IGL00975:Inpp5j APN 11 3502176 missense probably damaging 1.00
IGL01523:Inpp5j APN 11 3495932 unclassified probably null
IGL02472:Inpp5j APN 11 3495338 unclassified probably benign
IGL02512:Inpp5j APN 11 3499661 missense probably damaging 1.00
IGL02897:Inpp5j APN 11 3500619 missense probably damaging 1.00
IGL03408:Inpp5j APN 11 3502809 missense possibly damaging 0.95
R0048:Inpp5j UTSW 11 3501417 missense probably damaging 0.97
R0440:Inpp5j UTSW 11 3501150 missense possibly damaging 0.95
R0455:Inpp5j UTSW 11 3503122 missense possibly damaging 0.66
R0483:Inpp5j UTSW 11 3499738 missense probably damaging 1.00
R0554:Inpp5j UTSW 11 3499644 missense probably damaging 1.00
R0639:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0673:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0926:Inpp5j UTSW 11 3501439 splice site probably benign
R1114:Inpp5j UTSW 11 3494814 missense possibly damaging 0.57
R1132:Inpp5j UTSW 11 3502305 missense possibly damaging 0.90
R1463:Inpp5j UTSW 11 3501147 missense probably benign 0.03
R1757:Inpp5j UTSW 11 3504738 missense possibly damaging 0.49
R1978:Inpp5j UTSW 11 3502150 missense probably damaging 1.00
R3078:Inpp5j UTSW 11 3503124 unclassified probably null
R3831:Inpp5j UTSW 11 3500229 missense probably damaging 1.00
R4012:Inpp5j UTSW 11 3500185 missense probably benign 0.06
R4183:Inpp5j UTSW 11 3501134 missense probably damaging 0.99
R4209:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4210:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4211:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4477:Inpp5j UTSW 11 3501625 missense probably damaging 1.00
R4729:Inpp5j UTSW 11 3495025 missense probably damaging 0.99
R4840:Inpp5j UTSW 11 3499676 missense probably damaging 1.00
R5025:Inpp5j UTSW 11 3500664 missense probably damaging 1.00
R5151:Inpp5j UTSW 11 3502270 missense probably damaging 1.00
R5195:Inpp5j UTSW 11 3499889 critical splice donor site probably null
R5623:Inpp5j UTSW 11 3494766 missense probably damaging 0.96
R6448:Inpp5j UTSW 11 3495387 missense probably damaging 0.99
R6465:Inpp5j UTSW 11 3502293 missense possibly damaging 0.84
R6723:Inpp5j UTSW 11 3500640 missense probably damaging 0.99
R6895:Inpp5j UTSW 11 3495557 splice site probably null
R7060:Inpp5j UTSW 11 3500133 splice site probably null
R7346:Inpp5j UTSW 11 3501065 missense probably damaging 1.00
T0975:Inpp5j UTSW 11 3502527 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGAGAAAGCTTGGGCCCTTG -3'
(R):5'- AGTAATATCTGCCTCTGCTATGCC -3'

Sequencing Primer
(F):5'- CCCTTGGTGGAGAGGTGGC -3'
(R):5'- TGCTATGCCAAGGCCATC -3'
Posted On2018-03-15