Incidental Mutation 'R6262:Efr3a'
ID506785
Institutional Source Beutler Lab
Gene Symbol Efr3a
Ensembl Gene ENSMUSG00000015002
Gene NameEFR3 homolog A
SynonymsA130089M23Rik, D030063F01Rik, C920006C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location65787034-65873816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65857474 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 675 (S675P)
Ref Sequence ENSEMBL: ENSMUSP00000148418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015146] [ENSMUST00000173858] [ENSMUST00000211878]
Predicted Effect probably benign
Transcript: ENSMUST00000015146
AA Change: S648P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000015146
Gene: ENSMUSG00000015002
AA Change: S648P

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 5e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173858
AA Change: S648P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134385
Gene: ENSMUSG00000015002
AA Change: S648P

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 8e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174749
Predicted Effect possibly damaging
Transcript: ENSMUST00000211878
AA Change: S675P

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000227340
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that plays a role in maintaining an active pool of phosphatidylinositol 4-kinase (PI4K) at the plasma membrane. This protein is thought to be a peripheral membrane protein that associates with the plasma membrane through palmitoylation. Studies indicate that this gene product plays a role in controlling G protein-coupled receptor (GPCR) activity by affecting receptor phosphorylation. Whole exome sequencing studies have implicated mutations in this gene with autism spectrum disorders. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Efr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Efr3a APN 15 65855417 missense possibly damaging 0.66
IGL01070:Efr3a APN 15 65853078 missense probably benign
IGL01366:Efr3a APN 15 65851150 missense probably benign 0.37
IGL01754:Efr3a APN 15 65854720 missense probably damaging 0.96
IGL02121:Efr3a APN 15 65871150 splice site probably benign
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0139:Efr3a UTSW 15 65845981 missense possibly damaging 0.58
R0449:Efr3a UTSW 15 65842704 missense probably damaging 1.00
R0786:Efr3a UTSW 15 65853551 missense possibly damaging 0.47
R0827:Efr3a UTSW 15 65853551 missense possibly damaging 0.70
R0843:Efr3a UTSW 15 65837423 splice site probably benign
R1433:Efr3a UTSW 15 65869057 intron probably benign
R1572:Efr3a UTSW 15 65854792 critical splice donor site probably null
R2290:Efr3a UTSW 15 65849839 missense probably benign 0.00
R2764:Efr3a UTSW 15 65849770 missense possibly damaging 0.94
R4170:Efr3a UTSW 15 65845982 missense probably damaging 0.98
R4368:Efr3a UTSW 15 65866780 missense possibly damaging 0.82
R4683:Efr3a UTSW 15 65819801 missense probably damaging 1.00
R4797:Efr3a UTSW 15 65857588 missense probably damaging 1.00
R5495:Efr3a UTSW 15 65815409 missense possibly damaging 0.73
R6552:Efr3a UTSW 15 65857490 missense possibly damaging 0.52
R6825:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6833:Efr3a UTSW 15 65842686 missense probably damaging 1.00
R6852:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6853:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6996:Efr3a UTSW 15 65848181 nonsense probably null
R7327:Efr3a UTSW 15 65819778 missense probably damaging 0.98
R7467:Efr3a UTSW 15 65857511 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AAGACGAGTCCTGACACCAG -3'
(R):5'- GCTTTGGGCCTGAAGAAAAG -3'

Sequencing Primer
(F):5'- TGACACCAGGGATTTGCTCAC -3'
(R):5'- AAGGAACTGTCAGCCTCT -3'
Posted On2018-03-15