Incidental Mutation 'R6262:Atp5a1'
ID506790
Institutional Source Beutler Lab
Gene Symbol Atp5a1
Ensembl Gene ENSMUSG00000025428
Gene NameATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1
SynonymsAtpm, Mom2, D18Ertd206e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77773729-77782869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77781212 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 429 (V429M)
Ref Sequence ENSEMBL: ENSMUSP00000026495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026495] [ENSMUST00000114748] [ENSMUST00000135678]
Predicted Effect probably damaging
Transcript: ENSMUST00000026495
AA Change: V429M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026495
Gene: ENSMUSG00000025428
AA Change: V429M

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
Pfam:ATP-synt_ab_N 67 135 3.4e-17 PFAM
Pfam:ATP-synt_ab 192 415 5.7e-76 PFAM
Pfam:ATP-synt_ab_C 427 528 1.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114748
AA Change: V379M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110396
Gene: ENSMUSG00000025428
AA Change: V379M

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 17 85 1.1e-19 PFAM
Pfam:ATP-synt_ab 141 365 4.8e-75 PFAM
Pfam:ATP-synt_ab_C 377 479 2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128073
Predicted Effect probably benign
Transcript: ENSMUST00000135678
SMART Domains Protein: ENSMUSP00000120436
Gene: ENSMUSG00000025428

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
PDB:2W6J|C 22 78 5e-27 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146869
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a targeted mutation of this gene display preweaning and embryonic lethality. Heterozygous mutants exhibit decreased body weight and lean body mass and reduced circulating insulin, serum albumin, and total protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Atp5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Atp5a1 APN 18 77777533 missense probably damaging 1.00
IGL01536:Atp5a1 APN 18 77780312 intron probably benign
IGL01585:Atp5a1 APN 18 77781058 missense possibly damaging 0.95
IGL02973:Atp5a1 APN 18 77780149 missense probably damaging 1.00
R0268:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0344:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0399:Atp5a1 UTSW 18 77781836 nonsense probably null
R0464:Atp5a1 UTSW 18 77779922 missense probably benign 0.04
R1471:Atp5a1 UTSW 18 77781269 missense probably damaging 1.00
R1476:Atp5a1 UTSW 18 77781925 missense probably benign 0.00
R1630:Atp5a1 UTSW 18 77777567 missense possibly damaging 0.94
R2102:Atp5a1 UTSW 18 77782317 missense probably damaging 0.99
R4424:Atp5a1 UTSW 18 77780066 intron probably benign
R4746:Atp5a1 UTSW 18 77778742 missense probably benign 0.00
R4864:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
R5191:Atp5a1 UTSW 18 77780229 missense probably damaging 1.00
R6217:Atp5a1 UTSW 18 77781356 missense probably benign
R6263:Atp5a1 UTSW 18 77779230 splice site probably null
R6284:Atp5a1 UTSW 18 77778468 missense probably benign 0.30
R6873:Atp5a1 UTSW 18 77775840 nonsense probably null
R7442:Atp5a1 UTSW 18 77779120 missense probably benign 0.04
X0021:Atp5a1 UTSW 18 77781273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGCCATTAATGTGGGTTTG -3'
(R):5'- TGGTACAGGCTACATTAATGGTAC -3'

Sequencing Primer
(F):5'- CATTAATGTGGGTTTGTCTGTGTCCC -3'
(R):5'- TGGTACAGCACAGACCCTAATTACAG -3'
Posted On2018-03-15