Incidental Mutation 'R6264:Anln'
ID506887
Institutional Source Beutler Lab
Gene Symbol Anln
Ensembl Gene ENSMUSG00000036777
Gene Nameanillin, actin binding protein
Synonyms1110037A17Rik, 2900037I21Rik, Scraps
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6264 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location22332012-22389188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22334117 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 186 (N186D)
Ref Sequence ENSEMBL: ENSMUSP00000149721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040912] [ENSMUST00000215006]
Predicted Effect probably benign
Transcript: ENSMUST00000040912
AA Change: N1043D

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000045873
Gene: ENSMUSG00000036777
AA Change: N1043D

DomainStartEndE-ValueType
low complexity region 97 121 N/A INTRINSIC
Pfam:Anillin_N 141 227 5e-34 PFAM
low complexity region 234 250 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
Pfam:Anillin_N 423 501 2.7e-6 PFAM
coiled coil region 566 599 N/A INTRINSIC
coiled coil region 710 729 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
Pfam:Anillin 797 950 8.8e-39 PFAM
PH 981 1106 1.8e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000215006
AA Change: N186D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217010
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin-binding protein that plays a role in cell growth and migration, and in cytokinesis. The encoded protein is thought to regulate actin cytoskeletal dynamics in podocytes, components of the glomerulus. Mutations in this gene are associated with focal segmental glomerulosclerosis 8. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,373,998 Y175H probably damaging Het
Agtpbp1 A T 13: 59,450,300 V1165D possibly damaging Het
Ahsg A G 16: 22,898,861 D224G probably benign Het
Akap11 T C 14: 78,512,421 D842G possibly damaging Het
Aqr A G 2: 114,109,964 Y1234H probably damaging Het
Ccdc162 A G 10: 41,694,468 F7S probably benign Het
Cltc T C 11: 86,705,258 Y1222C probably damaging Het
Coro2a C T 4: 46,562,912 V81I probably damaging Het
Cpa5 T C 6: 30,613,985 V42A probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Ddx6 A G 9: 44,628,752 N326D probably damaging Het
Dedd2 A G 7: 25,203,790 L248P possibly damaging Het
Frem3 T A 8: 80,615,203 I1375N probably damaging Het
Gm12185 T C 11: 48,916,175 N63S probably benign Het
Gm13089 T G 4: 143,699,152 T74P possibly damaging Het
H2-Aa A G 17: 34,283,198 S250P probably damaging Het
Hbs1l T C 10: 21,367,757 S667P possibly damaging Het
Hc T A 2: 35,006,273 probably null Het
Hoxd4 A T 2: 74,727,385 Y36F possibly damaging Het
Ifi207 A G 1: 173,727,545 V864A probably damaging Het
Igsf10 T A 3: 59,328,507 T1418S possibly damaging Het
Klhl41 T C 2: 69,679,832 probably null Het
Lman2l T C 1: 36,438,769 N162S probably damaging Het
Lrr1 T G 12: 69,168,881 V9G probably damaging Het
March5 T C 19: 37,220,741 I127T probably damaging Het
Med12l T C 3: 59,256,002 L1350P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 T A 11: 68,745,415 I210N probably benign Het
Myo5c A G 9: 75,275,554 N825S probably benign Het
Nav3 T C 10: 109,688,833 T2312A probably damaging Het
Ndrg4 G T 8: 95,709,768 R208L probably damaging Het
Nell2 G A 15: 95,346,825 P464S probably damaging Het
Nrxn3 T A 12: 90,332,237 Y374N probably damaging Het
Oprd1 A C 4: 132,114,054 C198G possibly damaging Het
Pik3ca T C 3: 32,440,714 probably null Het
Plin4 T G 17: 56,104,787 D748A possibly damaging Het
Prkg2 T G 5: 98,934,364 K52Q probably benign Het
Ptprk A T 10: 28,566,673 E890D probably damaging Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Ranbp6 T C 19: 29,812,626 T109A probably benign Het
Rarb T A 14: 16,818,819 M17L probably benign Het
Rasgrf2 T C 13: 92,030,785 H260R probably damaging Het
Rec8 T A 14: 55,619,179 D109E probably damaging Het
Scd4 C A 19: 44,338,959 S158* probably null Het
Scn7a T A 2: 66,675,526 E1673V possibly damaging Het
Sit1 A T 4: 43,482,651 D169E possibly damaging Het
Slc16a14 G T 1: 84,907,409 Q470K probably benign Het
Slc43a2 T A 11: 75,567,074 C392S possibly damaging Het
Smg1 A G 7: 118,166,087 probably benign Het
Sstr2 A T 11: 113,625,106 I284F probably damaging Het
Tep1 C T 14: 50,845,513 V1013M probably damaging Het
Tmem120b T G 5: 123,115,700 L232R probably damaging Het
Tmem9b C A 7: 109,745,405 V75F probably damaging Het
Trappc3 A G 4: 126,273,938 S97G probably damaging Het
Ube3c T C 5: 29,590,831 F73L probably damaging Het
Vmn1r127 C A 7: 21,319,005 C286F probably benign Het
Vmn1r44 T C 6: 89,893,670 S133P probably benign Het
Vps8 C T 16: 21,559,349 Q635* probably null Het
Vwa8 A G 14: 79,086,812 E1185G possibly damaging Het
Zfp354c G A 11: 50,815,447 T267I probably benign Het
Other mutations in Anln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Anln APN 9 22360824 nonsense probably null
IGL01634:Anln APN 9 22360475 missense probably benign 0.00
IGL02145:Anln APN 9 22338996 splice site probably null
IGL02296:Anln APN 9 22372187 missense possibly damaging 0.67
IGL02352:Anln APN 9 22368412 missense probably benign 0.00
IGL02601:Anln APN 9 22338035 missense probably damaging 0.99
IGL02821:Anln APN 9 22358122 missense possibly damaging 0.55
IGL02863:Anln APN 9 22376365 missense probably damaging 1.00
IGL03274:Anln APN 9 22382269 missense probably damaging 1.00
R0114:Anln UTSW 9 22353346 missense probably damaging 0.99
R0486:Anln UTSW 9 22352826 missense probably benign 0.31
R0712:Anln UTSW 9 22380298 missense probably benign 0.01
R1618:Anln UTSW 9 22350918 critical splice donor site probably null
R1734:Anln UTSW 9 22350955 missense possibly damaging 0.71
R1856:Anln UTSW 9 22353331 missense probably damaging 1.00
R1999:Anln UTSW 9 22333052 makesense probably null
R2073:Anln UTSW 9 22333168 missense probably benign 0.45
R2075:Anln UTSW 9 22333168 missense probably benign 0.45
R2696:Anln UTSW 9 22360963 missense probably benign 0.08
R2943:Anln UTSW 9 22356046 splice site probably null
R4278:Anln UTSW 9 22334000 critical splice donor site probably null
R4548:Anln UTSW 9 22362888 missense possibly damaging 0.80
R4887:Anln UTSW 9 22380188 missense possibly damaging 0.46
R4979:Anln UTSW 9 22376501 missense probably benign
R5087:Anln UTSW 9 22375044 missense possibly damaging 0.61
R5197:Anln UTSW 9 22352781 critical splice donor site probably null
R5353:Anln UTSW 9 22360517 missense probably damaging 1.00
R5748:Anln UTSW 9 22337934 missense probably damaging 0.97
R5863:Anln UTSW 9 22337984 missense probably damaging 0.99
R6146:Anln UTSW 9 22376308 nonsense probably null
R6152:Anln UTSW 9 22360507 missense probably damaging 0.98
R6170:Anln UTSW 9 22368497 missense probably benign 0.01
R6261:Anln UTSW 9 22364046 missense probably damaging 1.00
R6656:Anln UTSW 9 22351002 missense probably damaging 1.00
R6864:Anln UTSW 9 22382249 missense probably benign 0.36
Z1088:Anln UTSW 9 22362801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCATGACATCACTGACATTTTCC -3'
(R):5'- GGTGCTTGGCTACTTCATGC -3'

Sequencing Primer
(F):5'- GACATCACTGACATTTTCCATATGC -3'
(R):5'- GGTGCTTGGCTACTTCATGCTTATTC -3'
Posted On2018-03-15