Incidental Mutation 'R6264:Myo5c'
ID506889
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6264 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75275554 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 825 (N825S)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
AA Change: N825S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: N825S

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,373,998 Y175H probably damaging Het
Agtpbp1 A T 13: 59,450,300 V1165D possibly damaging Het
Ahsg A G 16: 22,898,861 D224G probably benign Het
Akap11 T C 14: 78,512,421 D842G possibly damaging Het
Anln T C 9: 22,334,117 N186D possibly damaging Het
Aqr A G 2: 114,109,964 Y1234H probably damaging Het
Ccdc162 A G 10: 41,694,468 F7S probably benign Het
Cltc T C 11: 86,705,258 Y1222C probably damaging Het
Coro2a C T 4: 46,562,912 V81I probably damaging Het
Cpa5 T C 6: 30,613,985 V42A probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Ddx6 A G 9: 44,628,752 N326D probably damaging Het
Dedd2 A G 7: 25,203,790 L248P possibly damaging Het
Frem3 T A 8: 80,615,203 I1375N probably damaging Het
Gm12185 T C 11: 48,916,175 N63S probably benign Het
Gm13089 T G 4: 143,699,152 T74P possibly damaging Het
H2-Aa A G 17: 34,283,198 S250P probably damaging Het
Hbs1l T C 10: 21,367,757 S667P possibly damaging Het
Hc T A 2: 35,006,273 probably null Het
Hoxd4 A T 2: 74,727,385 Y36F possibly damaging Het
Ifi207 A G 1: 173,727,545 V864A probably damaging Het
Igsf10 T A 3: 59,328,507 T1418S possibly damaging Het
Klhl41 T C 2: 69,679,832 probably null Het
Lman2l T C 1: 36,438,769 N162S probably damaging Het
Lrr1 T G 12: 69,168,881 V9G probably damaging Het
March5 T C 19: 37,220,741 I127T probably damaging Het
Med12l T C 3: 59,256,002 L1350P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 T A 11: 68,745,415 I210N probably benign Het
Nav3 T C 10: 109,688,833 T2312A probably damaging Het
Ndrg4 G T 8: 95,709,768 R208L probably damaging Het
Nell2 G A 15: 95,346,825 P464S probably damaging Het
Nrxn3 T A 12: 90,332,237 Y374N probably damaging Het
Oprd1 A C 4: 132,114,054 C198G possibly damaging Het
Pik3ca T C 3: 32,440,714 probably null Het
Plin4 T G 17: 56,104,787 D748A possibly damaging Het
Prkg2 T G 5: 98,934,364 K52Q probably benign Het
Ptprk A T 10: 28,566,673 E890D probably damaging Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Ranbp6 T C 19: 29,812,626 T109A probably benign Het
Rarb T A 14: 16,818,819 M17L probably benign Het
Rasgrf2 T C 13: 92,030,785 H260R probably damaging Het
Rec8 T A 14: 55,619,179 D109E probably damaging Het
Scd4 C A 19: 44,338,959 S158* probably null Het
Scn7a T A 2: 66,675,526 E1673V possibly damaging Het
Sit1 A T 4: 43,482,651 D169E possibly damaging Het
Slc16a14 G T 1: 84,907,409 Q470K probably benign Het
Slc43a2 T A 11: 75,567,074 C392S possibly damaging Het
Smg1 A G 7: 118,166,087 probably benign Het
Sstr2 A T 11: 113,625,106 I284F probably damaging Het
Tep1 C T 14: 50,845,513 V1013M probably damaging Het
Tmem120b T G 5: 123,115,700 L232R probably damaging Het
Tmem9b C A 7: 109,745,405 V75F probably damaging Het
Trappc3 A G 4: 126,273,938 S97G probably damaging Het
Ube3c T C 5: 29,590,831 F73L probably damaging Het
Vmn1r127 C A 7: 21,319,005 C286F probably benign Het
Vmn1r44 T C 6: 89,893,670 S133P probably benign Het
Vps8 C T 16: 21,559,349 Q635* probably null Het
Vwa8 A G 14: 79,086,812 E1185G possibly damaging Het
Zfp354c G A 11: 50,815,447 T267I probably benign Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCCTGAAGTTGCATCAG -3'
(R):5'- GACTTTTAAAGCAACCTCTCAGGC -3'

Sequencing Primer
(F):5'- TCTGATGGTAGAGATGTAAGAACC -3'
(R):5'- CAAACCCCCAGGACAGTGAGG -3'
Posted On2018-03-15