Incidental Mutation 'R6265:Slc6a6'
ID506940
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Namesolute carrier family 6 (neurotransmitter transporter, taurine), member 6
SynonymsTaut
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91684053-91759066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 91754915 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 575 (R575T)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
Predicted Effect probably damaging
Transcript: ENSMUST00000032185
AA Change: R575T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: R575T

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206988
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91741170 intron probably benign
IGL01829:Slc6a6 APN 6 91735189 missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91726069 missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91735179 missense probably benign
IGL02301:Slc6a6 APN 6 91726056 missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91749827 missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91748330 unclassified probably benign
animas UTSW 6 91740014 splice site probably null
durango UTSW 6 91723471 missense probably damaging 1.00
R0530:Slc6a6 UTSW 6 91724958 missense probably null 0.04
R1327:Slc6a6 UTSW 6 91726035 missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91740992 missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91741027 missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91724910 missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91735180 missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91726196 missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91735212 missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91741048 missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91726129 missense probably benign
R3403:Slc6a6 UTSW 6 91726129 missense probably benign
R3978:Slc6a6 UTSW 6 91755052 missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91741276 missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91723471 missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91726060 missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91735174 missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91745000 missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91723317 missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91741033 missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91754948 missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91740014 splice site probably null
R6262:Slc6a6 UTSW 6 91755032 missense possibly damaging 0.66
R6665:Slc6a6 UTSW 6 91726039 missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91752438 missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91741267 missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91723476 missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91741224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATGTGTGTACCCTGTC -3'
(R):5'- AAGCTCTGTAAACCTGGTCCTATG -3'

Sequencing Primer
(F):5'- TGTACCCTGTCTGTAAGCAAG -3'
(R):5'- CCTGGTCCTATGAGAATCTAACG -3'
Posted On2018-03-15