Incidental Mutation 'R6265:Slc25a21'
ID506966
Institutional Source Beutler Lab
Gene Symbol Slc25a21
Ensembl Gene ENSMUSG00000035472
Gene Namesolute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
Synonyms9930033G19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R6265 (G1)
Quality Score127.008
Status Validated
Chromosome12
Chromosomal Location56712634-57197472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57196900 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 14 (R14G)
Ref Sequence ENSEMBL: ENSMUSP00000039289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044634]
Predicted Effect probably benign
Transcript: ENSMUST00000044634
AA Change: R14G

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039289
Gene: ENSMUSG00000035472
AA Change: R14G

DomainStartEndE-ValueType
Pfam:Mito_carr 10 104 2.3e-24 PFAM
Pfam:Mito_carr 107 200 1.3e-16 PFAM
Pfam:Mito_carr 202 298 3.4e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A21 is a homolog of the S. cerevisiae ODC proteins, mitochondrial carriers that transport C5-C7 oxodicarboxylates across inner mitochondrial membranes. One of the species transported by ODC is 2-oxoadipate, a common intermediate in the catabolism of lysine, tryptophan, and hydroxylysine in mammals. Within mitochondria, 2-oxoadipate is converted into acetyl-CoA.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Ccdc24 G A 4: 117,871,177 Q47* probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Slc25a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Slc25a21 APN 12 56718137 splice site probably null
IGL00776:Slc25a21 APN 12 56770205 missense probably benign 0.43
IGL00788:Slc25a21 APN 12 56713812 utr 3 prime probably benign
IGL01396:Slc25a21 APN 12 57159189 missense probably benign
IGL01656:Slc25a21 APN 12 56738495 missense probably damaging 1.00
IGL03095:Slc25a21 APN 12 56738625 missense probably benign 0.09
R0285:Slc25a21 UTSW 12 56858025 critical splice donor site probably null
R1238:Slc25a21 UTSW 12 56738487 missense probably benign 0.00
R1509:Slc25a21 UTSW 12 56858079 missense probably benign 0.00
R1803:Slc25a21 UTSW 12 56858087 missense probably benign 0.01
R3862:Slc25a21 UTSW 12 56718135 splice site probably benign
R4684:Slc25a21 UTSW 12 57196936 missense probably benign 0.00
R4816:Slc25a21 UTSW 12 56713838 missense probably damaging 1.00
R5718:Slc25a21 UTSW 12 56718156 missense probably benign 0.00
R6953:Slc25a21 UTSW 12 57159169 missense probably benign
R7337:Slc25a21 UTSW 12 56858043 missense probably benign 0.03
U24488:Slc25a21 UTSW 12 56738497 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CATGCTCCATTCTAGGAACAGAG -3'
(R):5'- TTTAGCTGGATCGCAGCCAC -3'

Sequencing Primer
(F):5'- CCCTAGAGCAGAGCAGCTAGTG -3'
(R):5'- CCACACCGGGAAGAGTTCAG -3'
Posted On2018-03-15