Incidental Mutation 'R6266:Olfr1123'
ID506990
Institutional Source Beutler Lab
Gene Symbol Olfr1123
Ensembl Gene ENSMUSG00000043274
Gene Nameolfactory receptor 1123
SynonymsMOR264-17, GA_x6K02T2Q125-48917235-48918206
MMRRC Submission 044378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R6266 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87416635-87423211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87419006 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 319 (S319R)
Ref Sequence ENSEMBL: ENSMUSP00000058786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054974] [ENSMUST00000216208]
Predicted Effect probably benign
Transcript: ENSMUST00000054974
AA Change: S319R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000058786
Gene: ENSMUSG00000043274
AA Change: S319R

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 4.4e-52 PFAM
Pfam:7tm_1 54 303 2.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214663
Predicted Effect probably benign
Transcript: ENSMUST00000216208
AA Change: S317R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,312 V147I probably benign Het
2310035C23Rik T G 1: 105,731,282 probably null Het
Akr1c12 T C 13: 4,270,207 T295A probably benign Het
Aldh2 C A 5: 121,568,934 V217L probably damaging Het
Arap3 G A 18: 37,990,791 R392C probably damaging Het
Aurkaip1 T G 4: 155,832,520 L75R probably damaging Het
Blm C A 7: 80,499,940 K640N probably benign Het
Brap A T 5: 121,685,265 T487S probably benign Het
Ccser2 G A 14: 36,879,675 P276L probably damaging Het
Cdc42bpg A G 19: 6,311,473 E343G probably damaging Het
Cecr2 A G 6: 120,761,686 S1097G probably benign Het
D7Ertd443e A T 7: 134,349,785 V53D probably damaging Het
Ddx3y G A Y: 1,266,635 T274I probably damaging Homo
Dnah5 T A 15: 28,335,627 F2246L possibly damaging Het
Dock3 T A 9: 106,964,753 H959L probably damaging Het
Dpy19l1 A G 9: 24,439,146 S406P probably damaging Het
Efcab8 T C 2: 153,783,768 L116P probably damaging Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fbxl12 A T 9: 20,638,615 L271Q probably damaging Het
Fmn1 T A 2: 113,596,338 N1133K probably damaging Het
Frmpd2 T C 14: 33,565,907 S1219P probably benign Het
Gm7298 A T 6: 121,782,704 R1187S probably damaging Het
H6pd T C 4: 149,995,957 I136V probably benign Het
Hyal2 A G 9: 107,570,715 N189S probably benign Het
Jmjd1c C T 10: 67,249,660 P2410S probably damaging Het
Larp1 A G 11: 58,042,263 D231G probably damaging Het
Lilra5 T A 7: 4,241,928 S233T possibly damaging Het
Lrrc43 T C 5: 123,503,277 F508S probably damaging Het
Marc2 T C 1: 184,833,943 R85G probably damaging Het
March4 T C 1: 72,452,488 Y208C probably damaging Het
Nr1h2 A T 7: 44,552,052 C45* probably null Het
Olfr138 A G 17: 38,275,148 I126V probably benign Het
Ppp2r5d G T 17: 46,685,703 probably null Het
Prpf40a A T 2: 53,156,627 S324T probably benign Het
Psmb7 T C 2: 38,640,187 D94G probably damaging Het
Psmd11 A G 11: 80,445,941 T140A probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rbp3 G A 14: 33,954,461 R122H probably benign Het
Rrp8 T C 7: 105,736,389 E3G probably damaging Het
Sacm1l T C 9: 123,542,420 S37P probably damaging Het
Slc12a3 A G 8: 94,358,471 R939G possibly damaging Het
Slc20a1 T C 2: 129,209,894 S608P possibly damaging Het
Sntg1 T C 1: 8,554,729 Q281R possibly damaging Het
Tefm A G 11: 80,137,988 L194P probably damaging Het
Terf2ip T A 8: 112,011,915 V145E probably damaging Het
Tmem231 T A 8: 111,915,265 E219V probably null Het
Tmx3 T A 18: 90,537,210 probably null Het
Tns3 G A 11: 8,492,987 P459S probably damaging Het
Trav13d-1 T A 14: 52,851,763 S76R probably benign Het
Trp63 A G 16: 25,862,460 N254S probably damaging Het
Tsen34 A G 7: 3,693,985 probably benign Het
Unc13d A G 11: 116,068,238 V701A probably damaging Het
Usp36 A G 11: 118,268,585 S513P probably damaging Het
Uspl1 T A 5: 149,204,366 S392T probably damaging Het
Vmn2r102 T A 17: 19,678,745 C450S probably benign Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zkscan7 C T 9: 122,895,234 Q423* probably null Het
Other mutations in Olfr1123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr1123 APN 2 87418566 missense possibly damaging 0.75
IGL01067:Olfr1123 APN 2 87418370 missense probably benign 0.00
IGL01526:Olfr1123 APN 2 87418975 missense probably damaging 0.99
IGL01580:Olfr1123 APN 2 87418536 missense probably benign 0.06
IGL01986:Olfr1123 APN 2 87418536 missense probably benign 0.00
IGL02503:Olfr1123 APN 2 87418292 missense probably benign 0.03
IGL02527:Olfr1123 APN 2 87418837 missense probably damaging 1.00
IGL02731:Olfr1123 APN 2 87418707 missense probably benign 0.00
IGL03215:Olfr1123 APN 2 87418068 missense probably benign 0.05
IGL03366:Olfr1123 APN 2 87418243 missense possibly damaging 0.88
R0645:Olfr1123 UTSW 2 87418268 nonsense probably null
R1857:Olfr1123 UTSW 2 87418648 missense probably damaging 1.00
R2175:Olfr1123 UTSW 2 87418156 missense probably damaging 1.00
R3691:Olfr1123 UTSW 2 87418170 missense probably benign 0.20
R4082:Olfr1123 UTSW 2 87418457 nonsense probably null
R4635:Olfr1123 UTSW 2 87418699 missense probably benign 0.05
R4877:Olfr1123 UTSW 2 87418563 nonsense probably null
R5190:Olfr1123 UTSW 2 87418843 missense probably damaging 1.00
R5253:Olfr1123 UTSW 2 87418668 missense possibly damaging 0.64
R6784:Olfr1123 UTSW 2 87418452 missense probably benign 0.20
R6909:Olfr1123 UTSW 2 87418615 missense probably damaging 1.00
R7255:Olfr1123 UTSW 2 87418942 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCATCAGCCAAAGGAAGGAC -3'
(R):5'- TCTGGAAATATGGAAGCCCTG -3'

Sequencing Primer
(F):5'- GGAAGGACCAAAGCTTTCTCC -3'
(R):5'- ATGGAAGCCCTGTATTAAAGTGTG -3'
Posted On2018-03-15