Incidental Mutation 'R6266:Slc20a1'
ID506992
Institutional Source Beutler Lab
Gene Symbol Slc20a1
Ensembl Gene ENSMUSG00000027397
Gene Namesolute carrier family 20, member 1
SynonymsPiT-1, Glvr1, Glvr-1
MMRRC Submission 044378-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6266 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location129198764-129211616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129209894 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 608 (S608P)
Ref Sequence ENSEMBL: ENSMUSP00000105944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028880] [ENSMUST00000110315]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028880
AA Change: S608P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028880
Gene: ENSMUSG00000027397
AA Change: S608P

DomainStartEndE-ValueType
Pfam:PHO4 43 667 1.8e-162 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110315
AA Change: S608P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105944
Gene: ENSMUSG00000027397
AA Change: S608P

DomainStartEndE-ValueType
Pfam:PHO4 43 667 1.3e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144025
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-phosphate symporter that absorbs phosphate from interstitial fluid for use in cellular functions such as metabolism, signal transduction, and nucleic acid and lipid synthesis. The encoded protein is also a retroviral receptor, causing human cells to be susceptible to infection by gibbon ape leukemia virus, simian sarcoma-associated virus, feline leukemia virus subgroup B, and 10A1 murine leukemia virus.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit mid-gestation lethality associated with abnormal vitelline vasculature, growth retardation, and anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,742,312 V147I probably benign Het
2310035C23Rik T G 1: 105,731,282 probably null Het
Akr1c12 T C 13: 4,270,207 T295A probably benign Het
Aldh2 C A 5: 121,568,934 V217L probably damaging Het
Arap3 G A 18: 37,990,791 R392C probably damaging Het
Aurkaip1 T G 4: 155,832,520 L75R probably damaging Het
Blm C A 7: 80,499,940 K640N probably benign Het
Brap A T 5: 121,685,265 T487S probably benign Het
Ccser2 G A 14: 36,879,675 P276L probably damaging Het
Cdc42bpg A G 19: 6,311,473 E343G probably damaging Het
Cecr2 A G 6: 120,761,686 S1097G probably benign Het
D7Ertd443e A T 7: 134,349,785 V53D probably damaging Het
Ddx3y G A Y: 1,266,635 T274I probably damaging Homo
Dnah5 T A 15: 28,335,627 F2246L possibly damaging Het
Dock3 T A 9: 106,964,753 H959L probably damaging Het
Dpy19l1 A G 9: 24,439,146 S406P probably damaging Het
Efcab8 T C 2: 153,783,768 L116P probably damaging Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fbxl12 A T 9: 20,638,615 L271Q probably damaging Het
Fmn1 T A 2: 113,596,338 N1133K probably damaging Het
Frmpd2 T C 14: 33,565,907 S1219P probably benign Het
Gm7298 A T 6: 121,782,704 R1187S probably damaging Het
H6pd T C 4: 149,995,957 I136V probably benign Het
Hyal2 A G 9: 107,570,715 N189S probably benign Het
Jmjd1c C T 10: 67,249,660 P2410S probably damaging Het
Larp1 A G 11: 58,042,263 D231G probably damaging Het
Lilra5 T A 7: 4,241,928 S233T possibly damaging Het
Lrrc43 T C 5: 123,503,277 F508S probably damaging Het
Marc2 T C 1: 184,833,943 R85G probably damaging Het
March4 T C 1: 72,452,488 Y208C probably damaging Het
Nr1h2 A T 7: 44,552,052 C45* probably null Het
Olfr1123 T A 2: 87,419,006 S319R probably benign Het
Olfr138 A G 17: 38,275,148 I126V probably benign Het
Ppp2r5d G T 17: 46,685,703 probably null Het
Prpf40a A T 2: 53,156,627 S324T probably benign Het
Psmb7 T C 2: 38,640,187 D94G probably damaging Het
Psmd11 A G 11: 80,445,941 T140A probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rbp3 G A 14: 33,954,461 R122H probably benign Het
Rrp8 T C 7: 105,736,389 E3G probably damaging Het
Sacm1l T C 9: 123,542,420 S37P probably damaging Het
Slc12a3 A G 8: 94,358,471 R939G possibly damaging Het
Sntg1 T C 1: 8,554,729 Q281R possibly damaging Het
Tefm A G 11: 80,137,988 L194P probably damaging Het
Terf2ip T A 8: 112,011,915 V145E probably damaging Het
Tmem231 T A 8: 111,915,265 E219V probably null Het
Tmx3 T A 18: 90,537,210 probably null Het
Tns3 G A 11: 8,492,987 P459S probably damaging Het
Trav13d-1 T A 14: 52,851,763 S76R probably benign Het
Trp63 A G 16: 25,862,460 N254S probably damaging Het
Tsen34 A G 7: 3,693,985 probably benign Het
Unc13d A G 11: 116,068,238 V701A probably damaging Het
Usp36 A G 11: 118,268,585 S513P probably damaging Het
Uspl1 T A 5: 149,204,366 S392T probably damaging Het
Vmn2r102 T A 17: 19,678,745 C450S probably benign Het
Zfp128 T C 7: 12,890,970 Y422H possibly damaging Het
Zkscan7 C T 9: 122,895,234 Q423* probably null Het
Other mutations in Slc20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Slc20a1 APN 2 129209226 splice site probably benign
IGL02563:Slc20a1 APN 2 129207684 missense probably benign
R0037:Slc20a1 UTSW 2 129210772 missense probably damaging 1.00
R0514:Slc20a1 UTSW 2 129199891 missense probably damaging 1.00
R1221:Slc20a1 UTSW 2 129208404 missense probably benign 0.44
R2099:Slc20a1 UTSW 2 129207838 missense probably benign 0.00
R2122:Slc20a1 UTSW 2 129199819 missense possibly damaging 0.86
R2261:Slc20a1 UTSW 2 129206474 missense possibly damaging 0.85
R2426:Slc20a1 UTSW 2 129208230 missense probably benign 0.13
R3428:Slc20a1 UTSW 2 129200282 missense probably benign
R4712:Slc20a1 UTSW 2 129199691 splice site probably benign
R4981:Slc20a1 UTSW 2 129199999 missense probably damaging 1.00
R5213:Slc20a1 UTSW 2 129200509 missense probably damaging 1.00
R5395:Slc20a1 UTSW 2 129208337 missense probably damaging 1.00
R5506:Slc20a1 UTSW 2 129210819 missense probably benign 0.00
R6255:Slc20a1 UTSW 2 129208004 missense probably damaging 0.99
R7022:Slc20a1 UTSW 2 129200059 missense probably damaging 0.99
R7091:Slc20a1 UTSW 2 129208272 missense possibly damaging 0.85
R7175:Slc20a1 UTSW 2 129210742 missense probably damaging 1.00
R7250:Slc20a1 UTSW 2 129209924 missense possibly damaging 0.78
X0067:Slc20a1 UTSW 2 129199888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTTGGCTCAATTTAAGTAGG -3'
(R):5'- TTCACCAAGAGACTGCCCTTAC -3'

Sequencing Primer
(F):5'- CTTGGCTCAATTTAAGTAGGTTTTTG -3'
(R):5'- GCCTCACAAACTTGTTAAAACCAGTG -3'
Posted On2018-03-15