Incidental Mutation 'R6267:Abi3bp'
ID507114
Institutional Source Beutler Lab
Gene Symbol Abi3bp
Ensembl Gene ENSMUSG00000035258
Gene NameABI gene family, member 3 (NESH) binding protein
SynonymsD930038M13Rik, eratin, TARSH, 5033411B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6267 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location56477878-56690135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56594497 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 341 (T341A)
Ref Sequence ENSEMBL: ENSMUSP00000156180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]
Predicted Effect probably benign
Transcript: ENSMUST00000048471
AA Change: T341A

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258
AA Change: T341A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 734 747 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
FN3 941 1024 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096012
AA Change: T341A

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258
AA Change: T341A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 651 664 N/A INTRINSIC
FN3 841 924 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096013
AA Change: T341A

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258
AA Change: T341A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
FN3 877 960 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171000
AA Change: T341A

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258
AA Change: T341A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 464 477 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
FN3 671 754 6.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231337
Predicted Effect probably benign
Transcript: ENSMUST00000231781
AA Change: T341A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000231832
Predicted Effect probably damaging
Transcript: ENSMUST00000231870
AA Change: T341A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Acer2 T C 4: 86,874,586 F33S probably damaging Het
Actr1b A G 1: 36,701,163 V299A possibly damaging Het
Ampd3 T A 7: 110,791,180 probably null Het
Atm A C 9: 53,444,000 I2898R probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Chd2 T C 7: 73,463,671 E1187G probably damaging Het
Cntrl T C 2: 35,129,793 L544P probably damaging Het
Cryga A C 1: 65,103,010 S75A probably benign Het
Dcbld1 T A 10: 52,319,480 Y261* probably null Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dst A C 1: 34,228,672 D5065A probably damaging Het
Dusp16 C A 6: 134,720,493 probably null Het
Eif4enif1 T A 11: 3,227,793 V395E probably damaging Het
Enox1 A G 14: 77,577,764 T121A probably damaging Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Fcrl5 G A 3: 87,448,324 G448E probably damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Garnl3 T C 2: 33,104,880 D39G probably benign Het
Gm14295 C T 2: 176,808,989 Q91* probably null Het
Grb10 T A 11: 11,970,639 probably benign Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Herc2 T A 7: 56,153,166 C2112* probably null Het
Herc2 T G 7: 56,204,718 L3797R possibly damaging Het
Ighm T C 12: 113,421,567 I258V unknown Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kif13b A G 14: 64,738,634 Y466C probably damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lingo4 G A 3: 94,403,390 G545E probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lor C A 3: 92,081,812 G56* probably null Het
Lrfn1 A G 7: 28,459,744 R363G probably benign Het
Lrp1b T C 2: 40,657,525 D446G probably benign Het
Ltbp1 G T 17: 75,005,989 G35V possibly damaging Het
Magel2 G A 7: 62,378,679 V444M probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Ms4a7 A T 19: 11,333,295 I20N possibly damaging Het
Myo5b A G 18: 74,616,991 Y173C probably damaging Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nmnat2 A T 1: 153,076,971 H102L probably damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr686 G A 7: 105,203,392 T317I probably damaging Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Pitpnm1 T C 19: 4,110,522 L781P probably damaging Het
Prdm14 A T 1: 13,118,936 C395S probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rorb C A 19: 18,977,857 V47L possibly damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Sdr16c5 C T 4: 4,016,162 G88E probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Slc52a3 G T 2: 152,007,609 probably null Het
Smco1 A T 16: 32,274,014 M168L probably benign Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tmem225 T A 9: 40,148,435 I37N probably damaging Het
Unkl T C 17: 25,231,865 *232R probably null Het
Usp16 A G 16: 87,483,191 N813S probably benign Het
Vmn1r128 A T 7: 21,350,296 *308C probably null Het
Vmn2r45 A G 7: 8,472,208 V607A probably benign Het
Vmn2r63 A T 7: 42,928,635 probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Abi3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Abi3bp APN 16 56602805 missense probably null 0.99
IGL01580:Abi3bp APN 16 56675210 missense probably damaging 1.00
IGL01633:Abi3bp APN 16 56677800 missense probably damaging 1.00
IGL01783:Abi3bp APN 16 56532969 critical splice donor site probably null
IGL01866:Abi3bp APN 16 56671973 missense probably benign 0.19
IGL02022:Abi3bp APN 16 56592636 missense probably damaging 1.00
IGL02086:Abi3bp APN 16 56642567 splice site probably benign
IGL02122:Abi3bp APN 16 56687128 splice site probably benign
IGL02155:Abi3bp APN 16 56587964 missense probably damaging 0.99
IGL02351:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02358:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02418:Abi3bp APN 16 56604116 splice site probably benign
IGL02559:Abi3bp APN 16 56687070 nonsense probably null
IGL02617:Abi3bp APN 16 56574444 nonsense probably null
IGL02810:Abi3bp APN 16 56677775 missense probably damaging 1.00
IGL03057:Abi3bp APN 16 56668391 missense possibly damaging 0.95
IGL03174:Abi3bp APN 16 56614747 missense possibly damaging 0.64
R0389:Abi3bp UTSW 16 56671307 missense possibly damaging 0.79
R0485:Abi3bp UTSW 16 56604012 intron probably null
R0557:Abi3bp UTSW 16 56668387 missense probably damaging 0.97
R0616:Abi3bp UTSW 16 56654070 missense probably damaging 0.99
R0685:Abi3bp UTSW 16 56532953 missense possibly damaging 0.90
R0783:Abi3bp UTSW 16 56595238 critical splice acceptor site probably null
R0828:Abi3bp UTSW 16 56677830 missense probably damaging 1.00
R0841:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1078:Abi3bp UTSW 16 56654081 critical splice donor site probably null
R1101:Abi3bp UTSW 16 56606158 missense probably damaging 1.00
R1116:Abi3bp UTSW 16 56686429 splice site probably benign
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1317:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1384:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1460:Abi3bp UTSW 16 56562417 missense probably damaging 0.99
R1730:Abi3bp UTSW 16 56668279 missense possibly damaging 0.62
R1761:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1830:Abi3bp UTSW 16 56587985 missense probably damaging 1.00
R1873:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1875:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1996:Abi3bp UTSW 16 56671357 missense possibly damaging 0.61
R2018:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2019:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2035:Abi3bp UTSW 16 56660218 missense probably benign 0.21
R2118:Abi3bp UTSW 16 56477864 unclassified probably benign
R2202:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R2202:Abi3bp UTSW 16 56650725 nonsense probably null
R2203:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R3030:Abi3bp UTSW 16 56657319 missense possibly damaging 0.79
R3952:Abi3bp UTSW 16 56604038 missense possibly damaging 0.88
R4176:Abi3bp UTSW 16 56652200 missense probably damaging 0.96
R4296:Abi3bp UTSW 16 56668310 missense probably benign 0.05
R4301:Abi3bp UTSW 16 56556903 missense probably damaging 1.00
R4354:Abi3bp UTSW 16 56532951 missense probably benign 0.05
R4417:Abi3bp UTSW 16 56654035 missense probably damaging 1.00
R4716:Abi3bp UTSW 16 56650725 nonsense probably null
R4808:Abi3bp UTSW 16 56594516 missense probably damaging 0.96
R4814:Abi3bp UTSW 16 56650753 missense probably benign 0.06
R5016:Abi3bp UTSW 16 56671268 missense probably damaging 0.97
R5290:Abi3bp UTSW 16 56642475 splice site probably null
R5891:Abi3bp UTSW 16 56606133 missense probably damaging 1.00
R5897:Abi3bp UTSW 16 56604669 missense possibly damaging 0.53
R6146:Abi3bp UTSW 16 56671265 missense probably damaging 0.99
R6905:Abi3bp UTSW 16 56574517 missense probably damaging 1.00
R6908:Abi3bp UTSW 16 56657305 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACCTGGAAAGGGTGGATC -3'
(R):5'- CAGCTCTCCAGTAGAACTTGTCC -3'

Sequencing Primer
(F):5'- CACCTGGGGCAAGTAGGTAGC -3'
(R):5'- CTCCAGTAGAACTTGTCCAAGAAATG -3'
Posted On2018-03-15