Incidental Mutation 'R6268:Cfap54'
ID507168
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6268 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93038909 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 542 (I542F)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020200] [ENSMUST00000168110] [ENSMUST00000168617] [ENSMUST00000170065] [ENSMUST00000212902]
Predicted Effect probably damaging
Transcript: ENSMUST00000020200
AA Change: I542F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020200
Gene: ENSMUSG00000020014
AA Change: I542F

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 103 643 3e-298 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168110
AA Change: I542F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: I542F

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168617
AA Change: I494F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127905
Gene: ENSMUSG00000020014
AA Change: I494F

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 103 148 4.3e-22 PFAM
Pfam:DUF4486 145 595 1.6e-244 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170065
Predicted Effect probably damaging
Transcript: ENSMUST00000212902
AA Change: I542F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
Afg3l1 A T 8: 123,492,926 I398F probably damaging Het
Ahctf1 T C 1: 179,763,483 H1244R probably benign Het
Ank1 A T 8: 23,109,671 K797N probably damaging Het
Anxa6 G T 11: 54,987,077 probably null Het
Ap1b1 T A 11: 5,019,493 V310E probably damaging Het
C2cd2l T C 9: 44,317,666 I123V probably damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cfap57 G T 4: 118,569,451 Y1100* probably null Het
Coq9 A G 8: 94,850,234 E158G probably benign Het
Cox15 A T 19: 43,739,926 W303R possibly damaging Het
Cpa5 A G 6: 30,615,173 Y103C probably damaging Het
Crygn A T 5: 24,756,191 V39E probably damaging Het
Csf1 G T 3: 107,747,157 S132R possibly damaging Het
Dapk1 G A 13: 60,761,766 V1398M possibly damaging Het
Degs2 C A 12: 108,692,580 V47L probably damaging Het
Dock5 C A 14: 67,790,275 E1057* probably null Het
Doxl2 T A 6: 48,977,682 Y585N probably benign Het
Dsg1b C A 18: 20,388,163 Q26K probably benign Het
Fam181a T C 12: 103,316,544 V236A possibly damaging Het
Fam78b C A 1: 167,078,553 P94T probably damaging Het
Fbxw25 T G 9: 109,654,650 T165P probably damaging Het
Flg C A 3: 93,288,175 probably benign Het
Frrs1 G T 3: 116,903,099 V573F probably damaging Het
Gm7298 A G 6: 121,779,073 T964A possibly damaging Het
Hoxd9 G T 2: 74,698,089 V12L probably damaging Het
Ikbkap T C 4: 56,762,305 Y1098C probably damaging Het
Kcnt1 A G 2: 25,903,597 probably null Het
Klhl3 G T 13: 58,013,842 R480S probably damaging Het
Klhl36 A G 8: 119,870,667 D369G probably damaging Het
Lama3 T A 18: 12,524,737 N303K probably damaging Het
Lhcgr T C 17: 88,742,704 T465A probably damaging Het
Llgl1 T C 11: 60,712,163 V888A probably benign Het
Lrp1b T A 2: 40,821,717 T3164S probably benign Het
Mmp3 T G 9: 7,447,622 D202E possibly damaging Het
Mocs1 C A 17: 49,435,155 T104K probably damaging Het
Mrpl42 A T 10: 95,496,707 probably null Het
Mtch2 T C 2: 90,863,648 C279R probably benign Het
Muc4 A T 16: 32,768,767 D2836V probably damaging Het
Myh7 T C 14: 54,989,284 E370G probably benign Het
Naa11 A G 5: 97,392,210 Y30H probably damaging Het
Ntng1 T C 3: 109,935,035 T141A probably damaging Het
Olfr1499 A T 19: 13,815,307 Y94* probably null Het
Olfr196 A C 16: 59,167,293 probably null Het
Olfr251 T C 9: 38,378,088 I69T probably benign Het
Pcdha12 G A 18: 37,022,424 C732Y possibly damaging Het
Plekhm2 G A 4: 141,632,341 Q392* probably null Het
Prr22 G A 17: 56,771,587 V247M probably damaging Het
Rapgef6 T A 11: 54,649,247 L716Q probably damaging Het
Rasgrp4 G A 7: 29,143,068 V246I probably damaging Het
Rhbdd2 C T 5: 135,643,260 T323I probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Scgb2b20 A T 7: 33,364,548 I99K possibly damaging Het
Scyl3 C T 1: 163,946,217 R324* probably null Het
Slc23a1 T C 18: 35,619,571 Y551C probably damaging Het
Slc5a5 A T 8: 70,888,620 S358R probably damaging Het
Sorcs3 T A 19: 48,790,166 N1007K probably damaging Het
Stxbp4 T A 11: 90,540,201 K428* probably null Het
Tmem63c T A 12: 87,081,953 I584N probably damaging Het
Traf3ip3 C T 1: 193,198,036 probably benign Het
Trgv2 G A 13: 19,336,831 T31I probably benign Het
Ttll3 C T 6: 113,392,563 R23C probably benign Het
Ugt2a3 A C 5: 87,329,613 L309R probably damaging Het
Urb1 A G 16: 90,753,919 M2015T probably benign Het
Vmn2r14 A C 5: 109,221,417 S97A possibly damaging Het
Vps13c C A 9: 67,951,449 T2727K probably benign Het
Xrn1 T A 9: 95,964,014 I40K probably damaging Het
Zc3h11a A G 1: 133,624,557 V604A probably benign Het
Zfp410 G A 12: 84,331,838 R259H probably benign Het
Zfp748 A G 13: 67,542,586 V185A possibly damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.28
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCAGATGCACTCACTAGCCC -3'
(R):5'- ATTTGAATCCCTAGCTGGACAG -3'

Sequencing Primer
(F):5'- AGCCCTTCTGCATTGGACATG -3'
(R):5'- GGACAGCTTATTCACTTTCTCCAGG -3'
Posted On2018-03-15