Mutagenetix > Incidental Mutation

Incidental Mutation 'R6268:Cox15'

507195

Institutional Source

Beutler Lab

Gene Symbol

Cox15

Ensembl Gene

ENSMUSG00000040018

Gene Name

cytochrome c oxidase assembly protein 15

Synonyms

2900026G05Rik

MMRRC Submission

044439-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6268 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43721693-43741439 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43728365 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 303 (W303R)

Ref Sequence

ENSEMBL: ENSMUSP00000041820 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045562]

AlphaFold

Q8BJ03

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045562
AA Change: W303R

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041820
Gene: ENSMUSG00000040018
AA Change: W303R

Domain	Start	End	E-Value	Type
Pfam:COX15-CtaA	73	402	2.3e-112	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129242

Meta Mutation Damage Score

0.9637

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be essential for the biogenesis of COX formation and may function in the hydroxylation of heme O, according to the yeast mutant studies. This protein is predicted to contain 5 transmembrane domains localized in the mitochondrial inner membrane. Alternative splicing of this gene generates two transcript variants diverging in the 3' region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	A	G	2: 19,545,219 (GRCm39)	I78T	probably benign	Het
Afg3l1	A	T	8: 124,219,665 (GRCm39)	I398F	probably damaging	Het
Ahctf1	T	C	1: 179,591,048 (GRCm39)	H1244R	probably benign	Het
Ank1	A	T	8: 23,599,687 (GRCm39)	K797N	probably damaging	Het
Anxa6	G	T	11: 54,877,903 (GRCm39)		probably null	Het
Aoc1l1	T	A	6: 48,954,616 (GRCm39)	Y585N	probably benign	Het
Ap1b1	T	A	11: 4,969,493 (GRCm39)	V310E	probably damaging	Het
C2cd2l	T	C	9: 44,228,963 (GRCm39)	I123V	probably damaging	Het
Cars2	TCCCC	TCCC	8: 11,579,599 (GRCm39)		probably null	Het
Cfap54	T	A	10: 92,874,771 (GRCm39)	I542F	probably damaging	Het
Cfap57	G	T	4: 118,426,648 (GRCm39)	Y1100*	probably null	Het
Coq9	A	G	8: 95,576,862 (GRCm39)	E158G	probably benign	Het
Cpa5	A	G	6: 30,615,172 (GRCm39)	Y103C	probably damaging	Het
Crygn	A	T	5: 24,961,189 (GRCm39)	V39E	probably damaging	Het
Csf1	G	T	3: 107,654,473 (GRCm39)	S132R	possibly damaging	Het
Dapk1	G	A	13: 60,909,580 (GRCm39)	V1398M	possibly damaging	Het
Degs2	C	A	12: 108,658,839 (GRCm39)	V47L	probably damaging	Het
Dock5	C	A	14: 68,027,724 (GRCm39)	E1057*	probably null	Het
Dsg1b	C	A	18: 20,521,220 (GRCm39)	Q26K	probably benign	Het
Elp1	T	C	4: 56,762,305 (GRCm39)	Y1098C	probably damaging	Het
Fam181a	T	C	12: 103,282,803 (GRCm39)	V236A	possibly damaging	Het
Fam78b	C	A	1: 166,906,122 (GRCm39)	P94T	probably damaging	Het
Fbxw25	T	G	9: 109,483,718 (GRCm39)	T165P	probably damaging	Het
Flg	C	A	3: 93,195,482 (GRCm39)		probably benign	Het
Frrs1	G	T	3: 116,696,748 (GRCm39)	V573F	probably damaging	Het
Gm7298	A	G	6: 121,756,032 (GRCm39)	T964A	possibly damaging	Het
Hoxd9	G	T	2: 74,528,433 (GRCm39)	V12L	probably damaging	Het
Kcnt1	A	G	2: 25,793,609 (GRCm39)		probably null	Het
Klhl3	G	T	13: 58,161,656 (GRCm39)	R480S	probably damaging	Het
Klhl36	A	G	8: 120,597,406 (GRCm39)	D369G	probably damaging	Het
Lama3	T	A	18: 12,657,794 (GRCm39)	N303K	probably damaging	Het
Lhcgr	T	C	17: 89,050,132 (GRCm39)	T465A	probably damaging	Het
Llgl1	T	C	11: 60,602,989 (GRCm39)	V888A	probably benign	Het
Lrp1b	T	A	2: 40,711,729 (GRCm39)	T3164S	probably benign	Het
Mmp3	T	G	9: 7,447,622 (GRCm39)	D202E	possibly damaging	Het
Mocs1	C	A	17: 49,742,183 (GRCm39)	T104K	probably damaging	Het
Mrpl42	A	T	10: 95,332,569 (GRCm39)		probably null	Het
Mtch2	T	C	2: 90,693,992 (GRCm39)	C279R	probably benign	Het
Muc4	A	T	16: 32,589,141 (GRCm39)	D2836V	probably damaging	Het
Myh7	T	C	14: 55,226,741 (GRCm39)	E370G	probably benign	Het
Naa11	A	G	5: 97,540,069 (GRCm39)	Y30H	probably damaging	Het
Ntng1	T	C	3: 109,842,351 (GRCm39)	T141A	probably damaging	Het
Or5h26	A	C	16: 58,987,656 (GRCm39)		probably null	Het
Or8c11	T	C	9: 38,289,384 (GRCm39)	I69T	probably benign	Het
Or9i14	A	T	19: 13,792,671 (GRCm39)	Y94*	probably null	Het
Pcdha12	G	A	18: 37,155,477 (GRCm39)	C732Y	possibly damaging	Het
Plekhm2	G	A	4: 141,359,652 (GRCm39)	Q392*	probably null	Het
Prr22	G	A	17: 57,078,587 (GRCm39)	V247M	probably damaging	Het
Rapgef6	T	A	11: 54,540,073 (GRCm39)	L716Q	probably damaging	Het
Rasgrp4	G	A	7: 28,842,493 (GRCm39)	V246I	probably damaging	Het
Rhbdd2	C	T	5: 135,672,114 (GRCm39)	T323I	probably benign	Het
Rsf1	CG	CGACGGCGGTG	7: 97,229,115 (GRCm39)		probably benign	Homo
Scgb2b20	A	T	7: 33,063,973 (GRCm39)	I99K	possibly damaging	Het
Scyl3	C	T	1: 163,773,786 (GRCm39)	R324*	probably null	Het
Slc23a1	T	C	18: 35,752,624 (GRCm39)	Y551C	probably damaging	Het
Slc5a5	A	T	8: 71,341,264 (GRCm39)	S358R	probably damaging	Het
Sorcs3	T	A	19: 48,778,605 (GRCm39)	N1007K	probably damaging	Het
Stxbp4	T	A	11: 90,431,027 (GRCm39)	K428*	probably null	Het
Tmem63c	T	A	12: 87,128,727 (GRCm39)	I584N	probably damaging	Het
Traf3ip3	C	T	1: 192,880,344 (GRCm39)		probably benign	Het
Trgv2	G	A	13: 19,521,001 (GRCm39)	T31I	probably benign	Het
Ttll3	C	T	6: 113,369,524 (GRCm39)	R23C	probably benign	Het
Ugt2a3	A	C	5: 87,477,472 (GRCm39)	L309R	probably damaging	Het
Urb1	A	G	16: 90,550,807 (GRCm39)	M2015T	probably benign	Het
Vmn2r14	A	C	5: 109,369,283 (GRCm39)	S97A	possibly damaging	Het
Vps13c	C	A	9: 67,858,731 (GRCm39)	T2727K	probably benign	Het
Xrn1	T	A	9: 95,846,067 (GRCm39)	I40K	probably damaging	Het
Zc3h11a	A	G	1: 133,552,295 (GRCm39)	V604A	probably benign	Het
Zfp410	G	A	12: 84,378,612 (GRCm39)	R259H	probably benign	Het
Zfp748	A	G	13: 67,690,705 (GRCm39)	V185A	possibly damaging	Het

Other mutations in Cox15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01472:Cox15	APN	19	43,732,104 (GRCm39)	nonsense	probably null
R0122:Cox15	UTSW	19	43,737,229 (GRCm39)	missense	possibly damaging	0.56
R1452:Cox15	UTSW	19	43,735,344 (GRCm39)	missense	probably damaging	1.00
R1931:Cox15	UTSW	19	43,735,224 (GRCm39)	missense	probably benign	0.01
R1932:Cox15	UTSW	19	43,735,224 (GRCm39)	missense	probably benign	0.01
R6720:Cox15	UTSW	19	43,725,228 (GRCm39)	missense	probably damaging	1.00
R7141:Cox15	UTSW	19	43,725,186 (GRCm39)	missense	probably benign	0.05
R7743:Cox15	UTSW	19	43,728,380 (GRCm39)	missense	possibly damaging	0.94
R8545:Cox15	UTSW	19	43,728,421 (GRCm39)	missense	probably damaging	1.00
R8698:Cox15	UTSW	19	43,739,948 (GRCm39)	missense	probably benign
R8725:Cox15	UTSW	19	43,735,181 (GRCm39)	nonsense	probably null
R8727:Cox15	UTSW	19	43,735,181 (GRCm39)	nonsense	probably null
R8941:Cox15	UTSW	19	43,732,172 (GRCm39)	missense	probably benign	0.01
R9650:Cox15	UTSW	19	43,735,318 (GRCm39)	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CATGCAGGATTGAGGGAGTC -3'
(R):5'- CACTGAGAACATTGTGAGTGCG -3'

Sequencing Primer
(F):5'- GCACTATTTGCCTGAATAAGCAG -3'
(R):5'- AGAACATTGTGAGTGCGTTCTTTC -3'

Posted On

2018-03-15