Incidental Mutation 'R6269:Pdlim5'
ID507206
Institutional Source Beutler Lab
Gene Symbol Pdlim5
Ensembl Gene ENSMUSG00000028273
Gene NamePDZ and LIM domain 5
SynonymsEnh3, Enh, Enh2, 1110001A05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location142239590-142395696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142312325 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 170 (T170A)
Ref Sequence ENSEMBL: ENSMUSP00000143098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029941] [ENSMUST00000058626] [ENSMUST00000090134] [ENSMUST00000168967] [ENSMUST00000170361] [ENSMUST00000195975] [ENSMUST00000196220] [ENSMUST00000196908] [ENSMUST00000198381] [ENSMUST00000200043]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029941
AA Change: T170A

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029941
Gene: ENSMUSG00000028273
AA Change: T170A

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Pfam:DUF4749 212 305 1.3e-9 PFAM
low complexity region 310 339 N/A INTRINSIC
LIM 414 465 3.17e-17 SMART
LIM 473 524 4.62e-19 SMART
LIM 532 585 1.79e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058626
SMART Domains Protein: ENSMUSP00000059267
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090134
SMART Domains Protein: ENSMUSP00000087595
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 111 118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168967
SMART Domains Protein: ENSMUSP00000132647
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170361
SMART Domains Protein: ENSMUSP00000128752
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
Pfam:DUF4749 101 207 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195975
SMART Domains Protein: ENSMUSP00000142737
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 237 246 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
low complexity region 333 362 N/A INTRINSIC
LIM 437 488 3.17e-17 SMART
LIM 496 547 4.62e-19 SMART
LIM 555 608 1.79e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196220
SMART Domains Protein: ENSMUSP00000142460
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
low complexity region 293 322 N/A INTRINSIC
LIM 397 448 3.17e-17 SMART
LIM 456 507 4.62e-19 SMART
LIM 515 568 1.79e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196908
AA Change: T170A

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143098
Gene: ENSMUSG00000028273
AA Change: T170A

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198381
SMART Domains Protein: ENSMUSP00000142899
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 201 230 N/A INTRINSIC
LIM 305 356 3.17e-17 SMART
LIM 364 415 4.62e-19 SMART
LIM 423 476 1.79e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200043
SMART Domains Protein: ENSMUSP00000143343
Gene: ENSMUSG00000028273

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 228 243 N/A INTRINSIC
low complexity region 245 274 N/A INTRINSIC
LIM 349 400 3.17e-17 SMART
LIM 408 459 4.62e-19 SMART
LIM 467 520 1.79e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired cardiac muscle contractility, wider Z-lines, and dilated cardiomyopathy. Mice heterozygous for a gene trap allele exhibit impaired response to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Pdlim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:Pdlim5 APN 3 142352787 missense probably damaging 1.00
R1868:Pdlim5 UTSW 3 142306299 critical splice acceptor site probably null
R1937:Pdlim5 UTSW 3 142244981 missense possibly damaging 0.46
R3000:Pdlim5 UTSW 3 142312131 missense probably damaging 1.00
R4477:Pdlim5 UTSW 3 142259217 missense probably benign 0.09
R4959:Pdlim5 UTSW 3 142311979 intron probably benign
R4973:Pdlim5 UTSW 3 142311979 intron probably benign
R5135:Pdlim5 UTSW 3 142304365 missense probably benign 0.34
R5393:Pdlim5 UTSW 3 142259186 missense probably damaging 1.00
R5445:Pdlim5 UTSW 3 142352734 missense probably null 1.00
R5707:Pdlim5 UTSW 3 142304299 missense probably damaging 1.00
R6154:Pdlim5 UTSW 3 142277913 missense possibly damaging 0.68
R6395:Pdlim5 UTSW 3 142314422 missense probably damaging 1.00
R6600:Pdlim5 UTSW 3 142259278 missense probably damaging 1.00
R6911:Pdlim5 UTSW 3 142304315 missense probably damaging 0.98
R7135:Pdlim5 UTSW 3 142311922 intron probably null
R7283:Pdlim5 UTSW 3 142311980 critical splice acceptor site probably null
R7334:Pdlim5 UTSW 3 142244917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAATGTCACCCTGGGATC -3'
(R):5'- AGGAAGTAGTTAAGCCTGTGC -3'

Sequencing Primer
(F):5'- AATGTCACCCTGGGATCCTCTTC -3'
(R):5'- GAAGTAGTTAAGCCTGTGCCCATTAC -3'
Posted On2018-03-15