Incidental Mutation 'R6269:Tcaf2'
ID507214
Institutional Source Beutler Lab
Gene Symbol Tcaf2
Ensembl Gene ENSMUSG00000029851
Gene NameTRPM8 channel-associated factor 2
SynonymsFam115c
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_146174.1; MGI:2385258

Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location42623016-42645254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42627408 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 679 (L679P)
Ref Sequence ENSEMBL: ENSMUSP00000031879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031879]
Predicted Effect probably damaging
Transcript: ENSMUST00000031879
AA Change: L679P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031879
Gene: ENSMUSG00000029851
AA Change: L679P

DomainStartEndE-ValueType
low complexity region 515 526 N/A INTRINSIC
M60-like 543 842 4.85e-138 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131341
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Tcaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tcaf2 APN 6 42630036 nonsense probably null
IGL00909:Tcaf2 APN 6 42624576 missense probably damaging 1.00
IGL01448:Tcaf2 APN 6 42630328 missense probably benign 0.05
IGL01870:Tcaf2 APN 6 42624477 missense possibly damaging 0.47
IGL02133:Tcaf2 APN 6 42627396 missense probably benign 0.06
IGL02208:Tcaf2 APN 6 42629086 missense probably damaging 1.00
IGL02666:Tcaf2 APN 6 42629124 splice site probably benign
PIT4260001:Tcaf2 UTSW 6 42642805 missense probably damaging 0.97
PIT4382001:Tcaf2 UTSW 6 42624366 makesense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0255:Tcaf2 UTSW 6 42642904 missense possibly damaging 0.95
R0617:Tcaf2 UTSW 6 42642511 missense probably damaging 0.97
R1387:Tcaf2 UTSW 6 42624578 missense probably damaging 1.00
R1523:Tcaf2 UTSW 6 42624451 nonsense probably null
R1529:Tcaf2 UTSW 6 42629506 missense probably benign 0.03
R1698:Tcaf2 UTSW 6 42628017 nonsense probably null
R1992:Tcaf2 UTSW 6 42629857 missense probably benign
R2065:Tcaf2 UTSW 6 42628047 missense probably benign 0.12
R2144:Tcaf2 UTSW 6 42642804 missense probably benign 0.45
R2435:Tcaf2 UTSW 6 42630364 missense possibly damaging 0.72
R2519:Tcaf2 UTSW 6 42629431 missense possibly damaging 0.92
R3979:Tcaf2 UTSW 6 42642547 missense probably damaging 1.00
R4093:Tcaf2 UTSW 6 42642838 missense probably damaging 1.00
R4532:Tcaf2 UTSW 6 42626437 missense probably damaging 1.00
R4780:Tcaf2 UTSW 6 42628062 missense probably damaging 1.00
R4906:Tcaf2 UTSW 6 42629745 missense probably benign 0.02
R4993:Tcaf2 UTSW 6 42642640 missense probably damaging 1.00
R5076:Tcaf2 UTSW 6 42629467 missense probably benign 0.16
R5643:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R5644:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R5975:Tcaf2 UTSW 6 42642778 missense probably benign 0.22
R6234:Tcaf2 UTSW 6 42630374 missense probably benign
R6276:Tcaf2 UTSW 6 42629753 missense probably benign 0.04
R6375:Tcaf2 UTSW 6 42626178 missense probably damaging 0.99
R6523:Tcaf2 UTSW 6 42643019 missense probably benign 0.01
R6825:Tcaf2 UTSW 6 42629518 missense probably benign 0.05
R7039:Tcaf2 UTSW 6 42626140 missense probably damaging 1.00
R7099:Tcaf2 UTSW 6 42630341 missense probably benign 0.02
R7284:Tcaf2 UTSW 6 42629538 missense probably damaging 1.00
Y4339:Tcaf2 UTSW 6 42629472 missense probably benign
Y4341:Tcaf2 UTSW 6 42629472 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAATGAACTTTGCTAACTAGGAGC -3'
(R):5'- ACGGACCTGCATGATTGTAG -3'

Sequencing Primer
(F):5'- GGAGCACTCCCCTGAAGCAC -3'
(R):5'- AACCCTCTCCTCAAGGCAAGTTTC -3'
Posted On2018-03-15