Incidental Mutation 'R6269:Zfp28'
ID507218
Institutional Source Beutler Lab
Gene Symbol Zfp28
Ensembl Gene ENSMUSG00000062861
Gene Namezinc finger protein 28
Synonymsmkr-5, 2810438M17Rik, Zfp-28
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6383295-6396915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6393613 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 349 (S349I)
Ref Sequence ENSEMBL: ENSMUSP00000079812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081022]
Predicted Effect probably benign
Transcript: ENSMUST00000081022
AA Change: S349I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079812
Gene: ENSMUSG00000062861
AA Change: S349I

DomainStartEndE-ValueType
low complexity region 27 50 N/A INTRINSIC
KRAB 103 163 3.53e-33 SMART
ZnF_C2H2 377 399 3.95e-4 SMART
ZnF_C2H2 405 427 6.88e-4 SMART
ZnF_C2H2 433 456 1.2e-3 SMART
ZnF_C2H2 462 484 9.58e-3 SMART
ZnF_C2H2 490 512 2.57e-3 SMART
ZnF_C2H2 518 540 1.82e-3 SMART
ZnF_C2H2 546 568 2.4e-3 SMART
ZnF_C2H2 574 596 6.32e-3 SMART
ZnF_C2H2 602 624 1.38e-3 SMART
ZnF_C2H2 630 652 4.87e-4 SMART
ZnF_C2H2 658 680 2.91e-2 SMART
ZnF_C2H2 686 708 2.36e-2 SMART
ZnF_C2H2 714 736 6.42e-4 SMART
ZnF_C2H2 742 764 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207086
Predicted Effect probably benign
Transcript: ENSMUST00000207465
Predicted Effect probably benign
Transcript: ENSMUST00000207809
Predicted Effect probably benign
Transcript: ENSMUST00000208338
Predicted Effect probably benign
Transcript: ENSMUST00000208949
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Other mutations in Zfp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Zfp28 APN 7 6393430 makesense probably null
IGL02300:Zfp28 APN 7 6389496 missense probably benign 0.00
IGL02541:Zfp28 APN 7 6393480 nonsense probably null
FR4340:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
FR4342:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
R0442:Zfp28 UTSW 7 6394999 missense probably damaging 1.00
R0462:Zfp28 UTSW 7 6392240 missense possibly damaging 0.71
R0799:Zfp28 UTSW 7 6384183 missense possibly damaging 0.49
R1081:Zfp28 UTSW 7 6389780 missense possibly damaging 0.93
R1674:Zfp28 UTSW 7 6394943 missense possibly damaging 0.90
R1783:Zfp28 UTSW 7 6394792 missense probably damaging 1.00
R2119:Zfp28 UTSW 7 6394876 missense probably benign 0.00
R2186:Zfp28 UTSW 7 6394498 missense probably damaging 1.00
R4280:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4281:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4283:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4331:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4379:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4380:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4505:Zfp28 UTSW 7 6394161 missense probably damaging 1.00
R4659:Zfp28 UTSW 7 6393507 missense probably benign 0.05
R4706:Zfp28 UTSW 7 6389794 missense probably damaging 0.99
R5524:Zfp28 UTSW 7 6394851 unclassified probably null
R6981:Zfp28 UTSW 7 6394693 missense probably damaging 1.00
R7117:Zfp28 UTSW 7 6394462 missense probably damaging 1.00
R7176:Zfp28 UTSW 7 6383457 missense possibly damaging 0.49
R7422:Zfp28 UTSW 7 6394749 missense probably damaging 1.00
R7423:Zfp28 UTSW 7 6393957 missense probably damaging 1.00
Y4340:Zfp28 UTSW 7 6394657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGAGCACTAAACTTGAGTG -3'
(R):5'- GCGAGGTGTTCTGTATGAAAGC -3'

Sequencing Primer
(F):5'- GAGTGCTCCACTTTCAGAGATCAG -3'
(R):5'- CCACACTGATTGCATTTATAGGGC -3'
Posted On2018-03-15