Incidental Mutation 'R6269:Atp10a'
ID507219
Institutional Source Beutler Lab
Gene Symbol Atp10a
Ensembl Gene ENSMUSG00000025324
Gene NameATPase, class V, type 10A
SynonymsAtp10c, pfatp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location58656166-58829420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58803739 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 855 (R855H)
Ref Sequence ENSEMBL: ENSMUSP00000129811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168747
AA Change: R855H

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: R855H

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 55 114 5.2e-23 PFAM
Pfam:E1-E2_ATPase 120 393 6.6e-10 PFAM
low complexity region 633 643 N/A INTRINSIC
Pfam:Cation_ATPase 685 791 1.5e-7 PFAM
Pfam:HAD 697 1054 2.1e-12 PFAM
Pfam:PhoLip_ATPase_C 1071 1316 1.1e-76 PFAM
low complexity region 1458 1477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Atp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Atp10a APN 7 58794482 missense probably benign 0.06
IGL00973:Atp10a APN 7 58807470 missense probably damaging 1.00
IGL00984:Atp10a APN 7 58658741 missense probably damaging 1.00
IGL01086:Atp10a APN 7 58824318 missense probably damaging 0.96
IGL01296:Atp10a APN 7 58813625 missense probably benign 0.02
IGL01731:Atp10a APN 7 58797562 missense probably benign 0.16
IGL02081:Atp10a APN 7 58827856 missense possibly damaging 0.62
IGL02095:Atp10a APN 7 58807393 missense probably damaging 1.00
IGL02549:Atp10a APN 7 58819733 missense probably benign 0.00
IGL02558:Atp10a APN 7 58819642 missense probably damaging 0.98
IGL02659:Atp10a APN 7 58813631 missense probably benign
IGL02986:Atp10a APN 7 58828721 missense probably benign
IGL03218:Atp10a APN 7 58788448 critical splice donor site probably null
PIT4260001:Atp10a UTSW 7 58791118 nonsense probably null
PIT4445001:Atp10a UTSW 7 58803467 missense probably damaging 0.98
PIT4810001:Atp10a UTSW 7 58813848 missense probably damaging 0.99
R0091:Atp10a UTSW 7 58774046 splice site probably benign
R0349:Atp10a UTSW 7 58803467 missense probably damaging 0.98
R0426:Atp10a UTSW 7 58784734 missense probably benign 0.00
R0609:Atp10a UTSW 7 58819740 splice site probably null
R0722:Atp10a UTSW 7 58816183 missense possibly damaging 0.75
R0741:Atp10a UTSW 7 58828589 missense possibly damaging 0.90
R1172:Atp10a UTSW 7 58803766 missense probably benign 0.05
R1342:Atp10a UTSW 7 58816146 splice site probably benign
R1648:Atp10a UTSW 7 58784827 missense probably damaging 1.00
R1715:Atp10a UTSW 7 58786505 missense probably damaging 0.98
R1737:Atp10a UTSW 7 58827238 splice site probably benign
R1799:Atp10a UTSW 7 58824434 missense probably damaging 1.00
R1909:Atp10a UTSW 7 58828712 missense probably benign 0.12
R1918:Atp10a UTSW 7 58827935 missense possibly damaging 0.82
R2031:Atp10a UTSW 7 58827930 nonsense probably null
R2080:Atp10a UTSW 7 58824327 missense probably damaging 0.97
R2424:Atp10a UTSW 7 58794555 missense probably benign 0.16
R2696:Atp10a UTSW 7 58813618 missense probably benign 0.00
R3932:Atp10a UTSW 7 58827104 missense possibly damaging 0.69
R4198:Atp10a UTSW 7 58813686 missense probably damaging 1.00
R4453:Atp10a UTSW 7 58658500 small deletion probably benign
R4632:Atp10a UTSW 7 58807438 missense possibly damaging 0.48
R4661:Atp10a UTSW 7 58658500 small deletion probably benign
R4782:Atp10a UTSW 7 58791095 missense probably benign
R4888:Atp10a UTSW 7 58785307 missense probably damaging 1.00
R4935:Atp10a UTSW 7 58813764 missense probably damaging 1.00
R5051:Atp10a UTSW 7 58740246 frame shift probably null
R5213:Atp10a UTSW 7 58773983 missense probably damaging 0.99
R5617:Atp10a UTSW 7 58803675 missense probably benign 0.06
R5834:Atp10a UTSW 7 58658618 missense probably benign 0.01
R5885:Atp10a UTSW 7 58813800 missense possibly damaging 0.92
R6013:Atp10a UTSW 7 58797790 missense probably benign 0.05
R6136:Atp10a UTSW 7 58828340 missense probably benign
R6380:Atp10a UTSW 7 58819684 nonsense probably null
R6743:Atp10a UTSW 7 58797814 missense possibly damaging 0.89
R6875:Atp10a UTSW 7 58797352 missense probably benign 0.01
R6975:Atp10a UTSW 7 58773985 missense probably damaging 1.00
R7082:Atp10a UTSW 7 58658819 missense probably damaging 1.00
R7203:Atp10a UTSW 7 58786473 missense probably benign
R7224:Atp10a UTSW 7 58797471 missense probably benign 0.00
R7287:Atp10a UTSW 7 58827269 missense probably damaging 1.00
R7437:Atp10a UTSW 7 58658540 missense unknown
R7474:Atp10a UTSW 7 58658527 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTTTATGCAGTAGAAGGCCTG -3'
(R):5'- TTCAGGCCAAGTGGTTCCTC -3'

Sequencing Primer
(F):5'- ACCCTGTGCATTGCCAAGAG -3'
(R):5'- CCAAGTGGTTCCTCAGACAAGG -3'
Posted On2018-03-15