Incidental Mutation 'R6269:Pgghg'
ID507227
Institutional Source Beutler Lab
Gene Symbol Pgghg
Ensembl Gene ENSMUSG00000062031
Gene Nameprotein glucosylgalactosylhydroxylysine glucosidase
Synonyms5730511L01Rik, Athl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140941391-140947664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140946184 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 563 (N563K)
Ref Sequence ENSEMBL: ENSMUSP00000128214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026562] [ENSMUST00000079403] [ENSMUST00000163094] [ENSMUST00000164580] [ENSMUST00000211129]
Predicted Effect probably benign
Transcript: ENSMUST00000026562
SMART Domains Protein: ENSMUSP00000026562
Gene: ENSMUSG00000025489

DomainStartEndE-ValueType
Pfam:CD225 26 102 1.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079403
AA Change: N563K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078372
Gene: ENSMUSG00000062031
AA Change: N563K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164337
SMART Domains Protein: ENSMUSP00000127119
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 219 464 3.8e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164580
AA Change: N563K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128214
Gene: ENSMUSG00000062031
AA Change: N563K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.6e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169736
Predicted Effect probably benign
Transcript: ENSMUST00000211129
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Pgghg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Pgghg APN 7 140945351 critical splice donor site probably null
IGL00848:Pgghg APN 7 140942404 missense probably damaging 1.00
IGL01903:Pgghg APN 7 140946828 missense probably benign 0.03
IGL02060:Pgghg APN 7 140946633 missense probably benign 0.30
IGL02475:Pgghg APN 7 140945720 missense
IGL02519:Pgghg APN 7 140944981 missense possibly damaging 0.94
IGL02612:Pgghg APN 7 140946338 missense probably damaging 1.00
R0689:Pgghg UTSW 7 140943278 missense probably benign 0.08
R1696:Pgghg UTSW 7 140945311 missense possibly damaging 0.55
R1960:Pgghg UTSW 7 140943347 missense probably benign
R2110:Pgghg UTSW 7 140943540 missense possibly damaging 0.72
R3809:Pgghg UTSW 7 140945295 missense probably damaging 1.00
R3890:Pgghg UTSW 7 140945703 missense probably damaging 0.99
R3891:Pgghg UTSW 7 140945703 missense probably damaging 0.99
R4622:Pgghg UTSW 7 140941496 unclassified probably null
R5009:Pgghg UTSW 7 140943390 missense probably benign
R5058:Pgghg UTSW 7 140942542 missense possibly damaging 0.46
R5215:Pgghg UTSW 7 140946564 missense possibly damaging 0.64
R6122:Pgghg UTSW 7 140943395 missense possibly damaging 0.87
R6301:Pgghg UTSW 7 140946376 missense probably damaging 1.00
R6562:Pgghg UTSW 7 140946593 missense probably benign 0.01
R7054:Pgghg UTSW 7 140944718 missense probably benign 0.15
R7241:Pgghg UTSW 7 140945720 missense
R7320:Pgghg UTSW 7 140943040 missense probably benign 0.44
R7486:Pgghg UTSW 7 140942480 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTATGAGGCCGTGACATCC -3'
(R):5'- GAAGTTCACTGCACCAGACC -3'

Sequencing Primer
(F):5'- CCTGCTATGACCTGGGTGAG -3'
(R):5'- AGACCCGTCTGCATTCTCCG -3'
Posted On2018-03-15