Incidental Mutation 'R6269:Slc25a3'
ID507234
Institutional Source Beutler Lab
Gene Symbol Slc25a3
Ensembl Gene ENSMUSG00000061904
Gene Namesolute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3
Synonyms5730556H19Rik, Phc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location91116574-91124059 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 91117101 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 314 (R314*)
Ref Sequence ENSEMBL: ENSMUSP00000127098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076694] [ENSMUST00000163246] [ENSMUST00000164505] [ENSMUST00000170810]
Predicted Effect probably null
Transcript: ENSMUST00000076694
AA Change: R313*
SMART Domains Protein: ENSMUSP00000075987
Gene: ENSMUSG00000061904
AA Change: R313*

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103979
Predicted Effect probably benign
Transcript: ENSMUST00000163246
SMART Domains Protein: ENSMUSP00000129301
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164505
AA Change: R313*
SMART Domains Protein: ENSMUSP00000132480
Gene: ENSMUSG00000061904
AA Change: R313*

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169339
Predicted Effect probably null
Transcript: ENSMUST00000170810
AA Change: R314*
SMART Domains Protein: ENSMUSP00000127098
Gene: ENSMUSG00000061904
AA Change: R314*

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 59 147 8.6e-21 PFAM
Pfam:Mito_carr 157 245 4.4e-19 PFAM
Pfam:Mito_carr 255 339 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172442
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the transport of phosphate into the mitochondrial matrix, either by proton cotransport or in exchange for hydroxyl ions. The protein contains three related segments arranged in tandem which are related to those found in other characterized members of the mitochondrial carrier family. Both the N-terminal and C-terminal regions of this protein protrude toward the cytosol. Multiple alternatively spliced transcript variants have been isolated. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Slc25a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Slc25a3 APN 10 91118125 missense probably damaging 0.96
IGL02193:Slc25a3 APN 10 91118115 missense probably benign 0.01
R1215:Slc25a3 UTSW 10 91117308 missense possibly damaging 0.95
R4737:Slc25a3 UTSW 10 91122188 missense possibly damaging 0.66
R5418:Slc25a3 UTSW 10 91119536 missense probably benign
R5799:Slc25a3 UTSW 10 91122041 missense probably benign
R6228:Slc25a3 UTSW 10 91122228 missense probably damaging 0.98
R6414:Slc25a3 UTSW 10 91122328 missense possibly damaging 0.66
R6866:Slc25a3 UTSW 10 91119705 missense probably damaging 0.99
R7404:Slc25a3 UTSW 10 91117040 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGATCAACAAGCAGATTCAGTCCATG -3'
(R):5'- CTGGAGTCTTCTGTGCGATC -3'

Sequencing Primer
(F):5'- GCAGATTCAGTCCATGTTACTTTG -3'
(R):5'- ACCCTGCTGACTCTGTGG -3'
Posted On2018-03-15