Incidental Mutation 'R6269:Vmn2r92'
ID507250
Institutional Source Beutler Lab
Gene Symbol Vmn2r92
Ensembl Gene ENSMUSG00000091350
Gene Namevomeronasal 2, receptor 92
SynonymsEG627111
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18151887-18188886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18166774 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 125 (I125K)
Ref Sequence ENSEMBL: ENSMUSP00000128685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169686]
Predicted Effect probably benign
Transcript: ENSMUST00000169686
AA Change: I125K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128685
Gene: ENSMUSG00000091350
AA Change: I125K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 463 4.7e-38 PFAM
Pfam:NCD3G 510 564 2.5e-19 PFAM
Pfam:7tm_3 597 832 1.1e-52 PFAM
low complexity region 843 855 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Prc1 G A 7: 80,309,427 R381Q probably damaging Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Vmn2r92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Vmn2r92 APN 17 18185161 missense unknown
IGL01758:Vmn2r92 APN 17 18152013 nonsense probably null
IGL02614:Vmn2r92 APN 17 18167241 splice site probably benign
IGL03095:Vmn2r92 APN 17 18166710 missense possibly damaging 0.55
IGL03403:Vmn2r92 APN 17 18166852 missense probably damaging 0.98
R0133:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0225:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0227:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0265:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0266:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0267:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0420:Vmn2r92 UTSW 17 18168921 missense probably benign 0.01
R0426:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0494:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R1253:Vmn2r92 UTSW 17 18166766 missense probably benign 0.08
R1497:Vmn2r92 UTSW 17 18167363 missense probably benign 0.02
R1571:Vmn2r92 UTSW 17 18152090 missense probably damaging 0.96
R1656:Vmn2r92 UTSW 17 18151936 missense probably benign
R1816:Vmn2r92 UTSW 17 18166677 missense probably damaging 0.98
R2229:Vmn2r92 UTSW 17 18167392 missense probably benign 0.01
R2909:Vmn2r92 UTSW 17 18185115 missense possibly damaging 0.89
R3694:Vmn2r92 UTSW 17 18151943 nonsense probably null
R4207:Vmn2r92 UTSW 17 18184261 missense possibly damaging 0.62
R4548:Vmn2r92 UTSW 17 18171316 missense probably benign
R4612:Vmn2r92 UTSW 17 18166870 missense probably benign 0.25
R4742:Vmn2r92 UTSW 17 18166857 missense probably benign 0.06
R4824:Vmn2r92 UTSW 17 18151921 utr 5 prime probably benign
R4865:Vmn2r92 UTSW 17 18167372 missense probably benign 0.16
R4900:Vmn2r92 UTSW 17 18184343 missense probably benign 0.27
R5084:Vmn2r92 UTSW 17 18185177 makesense probably null
R5140:Vmn2r92 UTSW 17 18152050 missense probably benign 0.07
R5995:Vmn2r92 UTSW 17 18168951 critical splice donor site probably null
R6045:Vmn2r92 UTSW 17 18168043 critical splice donor site probably null
R6877:Vmn2r92 UTSW 17 18168822 missense probably damaging 1.00
R7151:Vmn2r92 UTSW 17 18166743 missense probably benign 0.01
R7260:Vmn2r92 UTSW 17 18166876 missense probably damaging 1.00
R7344:Vmn2r92 UTSW 17 18167251 missense probably benign 0.01
X0066:Vmn2r92 UTSW 17 18184895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTTGCCTAAACCTAACG -3'
(R):5'- CCTGGCTCATTGACTACACC -3'

Sequencing Primer
(F):5'- GTGCTTGCCTAAACCTAACGTATTC -3'
(R):5'- GGCTCATTGACTACACCAACCTTTC -3'
Posted On2018-03-15