Incidental Mutation 'R6270:Ddr2'
ID507258
Institutional Source Beutler Lab
Gene Symbol Ddr2
Ensembl Gene ENSMUSG00000026674
Gene Namediscoidin domain receptor family, member 2
SynonymsNtrkr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location169972307-170110762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 169988540 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 533 (T533P)
Ref Sequence ENSEMBL: ENSMUSP00000141443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027985] [ENSMUST00000170800] [ENSMUST00000194690]
Predicted Effect probably benign
Transcript: ENSMUST00000027985
AA Change: T533P

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027985
Gene: ENSMUSG00000026674
AA Change: T533P

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170800
AA Change: T533P

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129624
Gene: ENSMUSG00000026674
AA Change: T533P

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194690
AA Change: T533P

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141443
Gene: ENSMUSG00000026674
AA Change: T533P

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, reduced chondrocyte proliferation, shortened long bones and snout, and skull anomalies. Homozygotes for another null allele show similar skeletal defects, small hearts, short cardiomyocytes, lower cardiac collagen density, and altered cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Ddr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ddr2 APN 1 169984427 missense possibly damaging 0.95
IGL00432:Ddr2 APN 1 169997958 missense probably benign 0.11
IGL00490:Ddr2 APN 1 170005194 missense probably damaging 1.00
IGL01343:Ddr2 APN 1 169984581 missense probably benign
IGL01898:Ddr2 APN 1 169998156 missense possibly damaging 0.85
IGL01899:Ddr2 APN 1 169984422 missense probably damaging 1.00
IGL01906:Ddr2 APN 1 169982099 missense probably damaging 1.00
IGL02115:Ddr2 APN 1 169994709 missense probably benign
IGL02330:Ddr2 APN 1 169988524 missense probably damaging 0.99
IGL02740:Ddr2 APN 1 169984945 missense probably damaging 1.00
IGL02828:Ddr2 APN 1 169988513 missense probably benign 0.34
debulked UTSW 1 169982098 missense probably damaging 1.00
fibro UTSW 1 170004812 splice site probably benign
fingers UTSW 1 169988540 missense probably benign 0.16
Julio UTSW 1 169997929 critical splice donor site probably null
phalanges UTSW 1 170005240 nonsense probably null
revolta UTSW 1 169988520 nonsense probably null
R0574:Ddr2 UTSW 1 169981963 splice site probably benign
R0730:Ddr2 UTSW 1 169995566 missense probably benign
R0733:Ddr2 UTSW 1 170004812 splice site probably benign
R0883:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R1340:Ddr2 UTSW 1 169998084 missense probably benign
R1815:Ddr2 UTSW 1 169995601 nonsense probably null
R1921:Ddr2 UTSW 1 170004245 missense probably damaging 1.00
R1924:Ddr2 UTSW 1 169982072 missense probably benign 0.01
R2016:Ddr2 UTSW 1 169984968 missense probably damaging 1.00
R2079:Ddr2 UTSW 1 170004776 nonsense probably null
R2178:Ddr2 UTSW 1 169994682 missense probably benign 0.18
R2903:Ddr2 UTSW 1 169998161 missense probably damaging 1.00
R3051:Ddr2 UTSW 1 169988455 missense probably benign 0.01
R3971:Ddr2 UTSW 1 169988417 missense probably damaging 1.00
R4290:Ddr2 UTSW 1 169990609 missense probably benign 0.00
R4494:Ddr2 UTSW 1 169988414 missense probably damaging 1.00
R4606:Ddr2 UTSW 1 170001852 missense probably benign 0.05
R4721:Ddr2 UTSW 1 170005240 nonsense probably null
R4734:Ddr2 UTSW 1 169998088 missense probably benign 0.41
R4855:Ddr2 UTSW 1 169988497 missense possibly damaging 0.94
R4871:Ddr2 UTSW 1 170004771 missense probably benign 0.19
R4923:Ddr2 UTSW 1 169997929 critical splice donor site probably null
R5207:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R5325:Ddr2 UTSW 1 170001837 missense probably benign 0.00
R5439:Ddr2 UTSW 1 170004729 missense possibly damaging 0.92
R5723:Ddr2 UTSW 1 169988520 nonsense probably null
R5833:Ddr2 UTSW 1 170004696 missense probably benign 0.01
R5924:Ddr2 UTSW 1 169994628 missense probably benign 0.03
R6020:Ddr2 UTSW 1 170005102 missense probably benign 0.15
R6326:Ddr2 UTSW 1 169987140 missense probably damaging 1.00
R6328:Ddr2 UTSW 1 169987065 missense possibly damaging 0.52
R6794:Ddr2 UTSW 1 169982098 missense probably damaging 1.00
R6925:Ddr2 UTSW 1 169998132 missense probably benign 0.01
R7011:Ddr2 UTSW 1 169982103 missense probably damaging 1.00
R7185:Ddr2 UTSW 1 169987054 missense probably damaging 1.00
R7248:Ddr2 UTSW 1 169994629 missense probably benign 0.01
R7278:Ddr2 UTSW 1 169984961 missense probably damaging 1.00
R7343:Ddr2 UTSW 1 169982078 missense probably damaging 1.00
R7366:Ddr2 UTSW 1 169997964 missense probably damaging 1.00
R7520:Ddr2 UTSW 1 169984439 missense probably damaging 1.00
R7571:Ddr2 UTSW 1 170001851 missense probably benign 0.05
X0004:Ddr2 UTSW 1 169987098 missense probably benign 0.10
X0027:Ddr2 UTSW 1 169982030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCACTTCTAGAGAGACACTTG -3'
(R):5'- TGGGGCTGGTTCTCACTATC -3'

Sequencing Primer
(F):5'- AGAGAGACACTTGTTCTGCTGATCC -3'
(R):5'- GGTTCTCACTATCCCCTCAGG -3'
Posted On2018-03-15