Incidental Mutation 'R6270:Tcaf3'
ID507268
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene NameTRPM8 channel-associated factor 3
SynonymsEapa2, Fam115e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42584866-42597692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42593791 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 342 (I342M)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: I342M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: I342M

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42593729 missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 unclassified probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42593715 missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42597185 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42593849 missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42593801 missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGTGATAGTTTGTCCCTTCAGG -3'
(R):5'- CAAACTATGCTGCCATTTGTGC -3'

Sequencing Primer
(F):5'- AATGGGAAACTGCCTCGCTG -3'
(R):5'- CTTAATGCTTTACACTGGCTGATG -3'
Posted On2018-03-15