Incidental Mutation 'R6270:Krt16'
ID507285
Institutional Source Beutler Lab
Gene Symbol Krt16
Ensembl Gene ENSMUSG00000053797
Gene Namekeratin 16
SynonymsKrt1-16, K16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6270 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100246091-100248902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100247203 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 316 (A316S)
Ref Sequence ENSEMBL: ENSMUSP00000007280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007280]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007280
AA Change: A316S

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007280
Gene: ENSMUSG00000053797
AA Change: A316S

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 112 423 8.41e-170 SMART
low complexity region 454 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119257
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The encoded protein is a cytokeratin and acts as an innate immune system effector, promoting the inflammatory response upon breach of the skin barrier. Defects in this gene are a cause of pachyonychia congenita. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal and postnatal lethality, decreased body weight, abnormal tongue epithelium and hyperkertotic calluses in areas of physical pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Krt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Krt16 APN 11 100248717 nonsense probably null
IGL01794:Krt16 APN 11 100247905 missense probably benign 0.00
IGL01795:Krt16 APN 11 100247724 splice site probably benign
IGL02221:Krt16 APN 11 100246336 splice site probably benign
IGL02243:Krt16 APN 11 100246336 splice site probably benign
IGL02410:Krt16 APN 11 100246336 splice site probably benign
IGL02451:Krt16 APN 11 100246336 splice site probably benign
IGL02457:Krt16 APN 11 100246336 splice site probably benign
IGL02512:Krt16 APN 11 100246336 splice site probably benign
IGL02745:Krt16 APN 11 100246336 splice site probably benign
IGL02867:Krt16 APN 11 100247576 missense probably damaging 1.00
PIT4131001:Krt16 UTSW 11 100248749 missense unknown
PIT4472001:Krt16 UTSW 11 100247906 missense probably benign 0.04
R0268:Krt16 UTSW 11 100246525 splice site probably benign
R0709:Krt16 UTSW 11 100246454 splice site probably benign
R1560:Krt16 UTSW 11 100246649 missense probably damaging 1.00
R1728:Krt16 UTSW 11 100247707 missense probably damaging 1.00
R1996:Krt16 UTSW 11 100248788 missense unknown
R2927:Krt16 UTSW 11 100248799 missense unknown
R3806:Krt16 UTSW 11 100248740 missense unknown
R3907:Krt16 UTSW 11 100247163 missense possibly damaging 0.83
R5133:Krt16 UTSW 11 100247631 missense probably damaging 0.99
R5412:Krt16 UTSW 11 100246767 missense probably damaging 1.00
R5723:Krt16 UTSW 11 100248446 missense probably damaging 0.99
R6368:Krt16 UTSW 11 100246676 missense probably damaging 1.00
R7191:Krt16 UTSW 11 100246658 missense probably damaging 1.00
R7314:Krt16 UTSW 11 100247869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCTATAATGGATACCATGGCGC -3'
(R):5'- ACCTCAGCCGCATTCTGAATG -3'

Sequencing Primer
(F):5'- GGCGCTTCCAGTCTCATTC -3'
(R):5'- CTCAGCCGCATTCTGAATGAGATG -3'
Posted On2018-03-15