Incidental Mutation 'R6270:Serinc5'
ID507291
Institutional Source Beutler Lab
Gene Symbol Serinc5
Ensembl Gene ENSMUSG00000021703
Gene Nameserine incorporator 5
SynonymsTPO1, AIGP3, A130038L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location92611091-92711947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92688662 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 200 (S200P)
Ref Sequence ENSEMBL: ENSMUSP00000047547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049488]
Predicted Effect probably damaging
Transcript: ENSMUST00000049488
AA Change: S200P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047547
Gene: ENSMUSG00000021703
AA Change: S200P

DomainStartEndE-ValueType
Pfam:Serinc 12 458 6.8e-155 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224250
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Serinc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Serinc5 APN 13 92706271 missense probably damaging 0.96
IGL01954:Serinc5 APN 13 92682933 missense probably damaging 1.00
IGL02248:Serinc5 APN 13 92706140 missense probably damaging 1.00
IGL03259:Serinc5 APN 13 92690992 missense probably damaging 1.00
R0352:Serinc5 UTSW 13 92707989 splice site probably null
R0600:Serinc5 UTSW 13 92708057 missense probably damaging 1.00
R0646:Serinc5 UTSW 13 92688737 missense possibly damaging 0.82
R0944:Serinc5 UTSW 13 92661105 missense probably damaging 1.00
R0972:Serinc5 UTSW 13 92688620 missense probably benign 0.18
R1163:Serinc5 UTSW 13 92682777 missense probably damaging 1.00
R1459:Serinc5 UTSW 13 92661187 critical splice donor site probably null
R1703:Serinc5 UTSW 13 92688797 missense probably damaging 0.99
R1866:Serinc5 UTSW 13 92706263 missense probably damaging 0.99
R1887:Serinc5 UTSW 13 92701706 missense possibly damaging 0.70
R3018:Serinc5 UTSW 13 92688681 missense probably benign 0.01
R4863:Serinc5 UTSW 13 92690980 missense probably damaging 1.00
R5694:Serinc5 UTSW 13 92688794 missense probably benign 0.00
R5715:Serinc5 UTSW 13 92706202 missense probably damaging 1.00
R5979:Serinc5 UTSW 13 92661136 missense probably benign 0.01
R6228:Serinc5 UTSW 13 92708108 missense probably damaging 1.00
R6592:Serinc5 UTSW 13 92708126 missense possibly damaging 0.88
R6622:Serinc5 UTSW 13 92688686 missense probably benign 0.05
R6787:Serinc5 UTSW 13 92706232 missense possibly damaging 0.60
X0018:Serinc5 UTSW 13 92661075 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTAGGCTCTGTGGTTCCAG -3'
(R):5'- TGGGCTTCTAAAGAAACCTACTGG -3'

Sequencing Primer
(F):5'- TCCAGGGTCTCTGCTGG -3'
(R):5'- AAACCATGCTTACGATTCTGGACG -3'
Posted On2018-03-15