Incidental Mutation 'R6270:Nudt18'
ID507294
Institutional Source Beutler Lab
Gene Symbol Nudt18
Ensembl Gene ENSMUSG00000045211
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70577637-70582688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70579390 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 145 (Y145H)
Ref Sequence ENSEMBL: ENSMUSP00000086450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022690] [ENSMUST00000089049] [ENSMUST00000228554] [ENSMUST00000228768]
Predicted Effect probably benign
Transcript: ENSMUST00000022690
SMART Domains Protein: ENSMUSP00000022690
Gene: ENSMUSG00000022095

DomainStartEndE-ValueType
Pfam:RAI16-like 79 477 7.7e-112 PFAM
low complexity region 516 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089049
AA Change: Y145H

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086450
Gene: ENSMUSG00000045211
AA Change: Y145H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:NUDIX 44 165 2.5e-18 PFAM
Predicted Effect silent
Transcript: ENSMUST00000228554
Predicted Effect probably benign
Transcript: ENSMUST00000228768
AA Change: Y87H

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. This protein contains a Nudix hydrolase domain and hydrolyzes oxidized forms of guanosine and deoxyguanosine diphosphates. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Nudt18
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1241:Nudt18 UTSW 14 70579427 missense probably benign 0.00
R1867:Nudt18 UTSW 14 70579895 missense probably damaging 1.00
R2033:Nudt18 UTSW 14 70579616 missense possibly damaging 0.69
R5016:Nudt18 UTSW 14 70579463 missense probably benign 0.28
R7078:Nudt18 UTSW 14 70579012 missense possibly damaging 0.50
R7247:Nudt18 UTSW 14 70577982 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCCATAGCCAGCCATACTGTG -3'
(R):5'- CACCGACTGGACTGTTGTGAAG -3'

Sequencing Primer
(F):5'- ACCTACTACGGGCTAAGAGCTTTTG -3'
(R):5'- ACTGTTGTGAAGGTGGTCAC -3'
Posted On2018-03-15