Incidental Mutation 'R6270:Pkdrej'
ID507296
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 85821105 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 210 (S210*)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect probably null
Transcript: ENSMUST00000064370
AA Change: S210*
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: S210*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 unclassified probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAGCCTGGTTGATCACTAATAC -3'
(R):5'- TTTCGGTGGCCTCTGTGAAC -3'

Sequencing Primer
(F):5'- GGTTGATCACTAATACATAGTTGCC -3'
(R):5'- TGAACGACACCCCTGATTGG -3'
Posted On2018-03-15