Incidental Mutation 'R6270:Tgif1'
ID507301
Institutional Source Beutler Lab
Gene Symbol Tgif1
Ensembl Gene ENSMUSG00000047407
Gene NameTGFB-induced factor homeobox 1
SynonymsTgif
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location70844205-70853546 bp(-) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) T to C at 70844866 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000059775] [ENSMUST00000118283] [ENSMUST00000127719] [ENSMUST00000134654] [ENSMUST00000135007] [ENSMUST00000166395] [ENSMUST00000172229] [ENSMUST00000186358]
Predicted Effect probably damaging
Transcript: ENSMUST00000059775
AA Change: E217G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060512
Gene: ENSMUSG00000047407
AA Change: E217G

DomainStartEndE-ValueType
HOX 35 100 1.53e-13 SMART
low complexity region 117 126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118283
AA Change: E197G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113192
Gene: ENSMUSG00000047407
AA Change: E197G

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125329
Predicted Effect probably damaging
Transcript: ENSMUST00000127719
AA Change: E197G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115375
Gene: ENSMUSG00000047407
AA Change: E197G

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132825
Predicted Effect probably benign
Transcript: ENSMUST00000134654
SMART Domains Protein: ENSMUSP00000125247
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:Homeobox_KN 33 58 7.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135007
SMART Domains Protein: ENSMUSP00000124168
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156484
SMART Domains Protein: ENSMUSP00000124970
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 6 57 2.23e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166395
AA Change: E250G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130930
Gene: ENSMUSG00000047407
AA Change: E250G

DomainStartEndE-ValueType
HOX 68 133 1.53e-13 SMART
low complexity region 150 159 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172229
AA Change: E197G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127139
Gene: ENSMUSG00000047407
AA Change: E197G

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186358
SMART Domains Protein: ENSMUSP00000139438
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 35 84 1.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190687
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display normal growth, behavior and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Esrra C T 19: 6,914,120 probably null Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Tgif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Tgif1 APN 17 70846240 missense probably damaging 1.00
IGL03169:Tgif1 APN 17 70844841 missense possibly damaging 0.93
IGL03179:Tgif1 APN 17 70844947 missense possibly damaging 0.80
R0050:Tgif1 UTSW 17 70850884 missense probably damaging 1.00
R4569:Tgif1 UTSW 17 70844917 missense possibly damaging 0.51
R4877:Tgif1 UTSW 17 70849705 utr 5 prime probably null
R4914:Tgif1 UTSW 17 70845247 missense probably damaging 1.00
R4985:Tgif1 UTSW 17 70844872 missense probably benign 0.02
R5272:Tgif1 UTSW 17 70846254 missense probably damaging 1.00
R5760:Tgif1 UTSW 17 70845001 missense probably damaging 1.00
R6528:Tgif1 UTSW 17 70846560 intron probably benign
R6693:Tgif1 UTSW 17 70850890 start gained probably benign
R7231:Tgif1 UTSW 17 70846173 missense probably damaging 1.00
R7319:Tgif1 UTSW 17 70844852 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACGGTTAAGCTGTGAGTTTG -3'
(R):5'- AGAGCCCATTTCATTCCTGC -3'

Sequencing Primer
(F):5'- GAGTTTGGCCTGAAGCTCCATC -3'
(R):5'- ATTCCTGCGTAGTTGGACC -3'
Posted On2018-03-15