Incidental Mutation 'R6270:Esrra'
ID507305
Institutional Source Beutler Lab
Gene Symbol Esrra
Ensembl Gene ENSMUSG00000024955
Gene Nameestrogen related receptor, alpha
SynonymsERRalpha, Err1, Estrra, Nr3b1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6270 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6910977-6921813 bp(-) (GRCm38)
Type of Mutationunclassified (3092 bp from exon)
DNA Base Change (assembly) C to T at 6914120 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025904] [ENSMUST00000025906] [ENSMUST00000088257] [ENSMUST00000116551] [ENSMUST00000173091] [ENSMUST00000173635] [ENSMUST00000174786]
Predicted Effect probably benign
Transcript: ENSMUST00000025904
SMART Domains Protein: ENSMUSP00000025904
Gene: ENSMUSG00000024953

DomainStartEndE-ValueType
Pfam:Redoxin 53 206 1e-31 PFAM
Pfam:AhpC-TSA 54 189 8.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025906
AA Change: C134Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025906
Gene: ENSMUSG00000024955
AA Change: C134Y

DomainStartEndE-ValueType
internal_repeat_1 5 21 6.74e-5 PROSPERO
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 76 147 2.16e-40 SMART
low complexity region 169 187 N/A INTRINSIC
internal_repeat_1 202 218 6.74e-5 PROSPERO
HOLI 229 391 9.21e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000088257
SMART Domains Protein: ENSMUSP00000085591
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116551
SMART Domains Protein: ENSMUSP00000112250
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172869
Predicted Effect probably benign
Transcript: ENSMUST00000173091
SMART Domains Protein: ENSMUSP00000134521
Gene: ENSMUSG00000024953

DomainStartEndE-ValueType
Pfam:Redoxin 53 99 3.3e-11 PFAM
Pfam:AhpC-TSA 54 100 9.3e-8 PFAM
Pfam:Redoxin 97 163 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173308
Predicted Effect probably benign
Transcript: ENSMUST00000173635
SMART Domains Protein: ENSMUSP00000134587
Gene: ENSMUSG00000024955

DomainStartEndE-ValueType
PDB:1LO1|A 1 21 6e-7 PDB
low complexity region 26 44 N/A INTRINSIC
Pfam:Hormone_recep 65 158 4.7e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174786
SMART Domains Protein: ENSMUSP00000134000
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 101 5.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183724
Meta Mutation Damage Score 0.782 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Homozygous mice for one mutation were viable but showed reduced weight gain associated with decreased peripheral fat deposition. Mutant mice were resistant to high-fat diet induced obesity. Another targeted mutation resulted in no significant abnormalities in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,421 D65G probably damaging Het
Acsl6 A G 11: 54,352,107 E648G probably benign Het
Ak7 A G 12: 105,768,701 H642R probably benign Het
Akap11 T C 14: 78,518,799 E53G probably damaging Het
Ddr2 T G 1: 169,988,540 T533P probably benign Het
Dhx40 A G 11: 86,799,605 S197P possibly damaging Het
Dolpp1 C A 2: 30,392,269 probably benign Het
Eng A G 2: 32,673,643 D347G probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fap T C 2: 62,547,788 I159V probably damaging Het
Fn1 C T 1: 71,637,275 C599Y probably damaging Het
Fnbp4 T C 2: 90,757,463 V395A probably damaging Het
Foxn3 T C 12: 99,388,417 R163G probably damaging Het
Gphn T G 12: 78,522,950 L306R probably benign Het
Gse1 T C 8: 120,569,163 probably benign Het
Habp2 A G 19: 56,306,863 D62G possibly damaging Het
Hdac7 AGGG AGGGG 15: 97,808,495 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Kit A G 5: 75,609,509 T194A probably benign Het
Krt16 C A 11: 100,247,203 A316S possibly damaging Het
Krt7 A G 15: 101,419,558 D244G probably damaging Het
Lhfpl3 T A 5: 23,273,351 Y77* probably null Het
Lrrc18 A T 14: 33,009,121 M206L probably benign Het
Magel2 C A 7: 62,380,658 C1103* probably null Het
Mcf2l T C 8: 13,018,701 V1058A probably damaging Het
Nbas G A 12: 13,324,293 A541T probably damaging Het
Nrap C T 19: 56,320,198 M1485I probably benign Het
Nudt18 T C 14: 70,579,390 Y145H probably benign Het
Olfr175-ps1 A T 16: 58,824,419 C97S probably damaging Het
Olfr583 T C 7: 103,051,331 L11P probably benign Het
Olfr623 T C 7: 103,660,413 Y279C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb12 A T 18: 37,436,785 Q328L possibly damaging Het
Pde6c T C 19: 38,158,436 W431R probably damaging Het
Pga5 T C 19: 10,674,861 E139G probably benign Het
Pkdrej G T 15: 85,821,105 S210* probably null Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Sema3d A T 5: 12,448,107 M27L probably benign Het
Serinc5 T C 13: 92,688,662 S200P probably damaging Het
Sf3b3 T C 8: 110,841,820 D174G probably damaging Het
Sult1b1 A T 5: 87,517,554 probably null Het
Tcaf3 T C 6: 42,593,791 I342M probably benign Het
Tenm3 G A 8: 48,367,394 T136M probably damaging Het
Tet3 T C 6: 83,375,791 T1008A possibly damaging Het
Tgif1 T C 17: 70,844,866 probably null Het
Trav15-2-dv6-2 A G 14: 53,649,866 D81G probably benign Het
Trpv5 T A 6: 41,674,359 H251L possibly damaging Het
Ttc14 C A 3: 33,800,388 T37K possibly damaging Het
Vmn2r80 A T 10: 79,194,325 I662L probably benign Het
Vmn2r81 A G 10: 79,293,815 I847V probably benign Het
Zfp474 A G 18: 52,638,364 T30A probably benign Het
Zswim4 C T 8: 84,230,951 V163M probably damaging Het
Other mutations in Esrra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Esrra APN 19 6912732 missense probably damaging 1.00
IGL02153:Esrra APN 19 6913822 missense probably benign 0.38
IGL02396:Esrra APN 19 6912005 missense probably benign
IGL02642:Esrra APN 19 6912850 missense possibly damaging 0.85
R1463:Esrra UTSW 19 6912455 missense probably benign
R1484:Esrra UTSW 19 6912829 missense probably damaging 1.00
R1546:Esrra UTSW 19 6920297 missense probably benign 0.07
R1848:Esrra UTSW 19 6912010 missense probably benign 0.05
R2397:Esrra UTSW 19 6920176 missense probably damaging 1.00
R4853:Esrra UTSW 19 6920072 missense probably damaging 1.00
R5580:Esrra UTSW 19 6920387 start codon destroyed probably null 0.01
R5587:Esrra UTSW 19 6920207 missense probably benign
R6612:Esrra UTSW 19 6911852 missense probably benign 0.01
R6807:Esrra UTSW 19 6911774 missense probably benign 0.14
R7288:Esrra UTSW 19 6912771 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGACGCACACCTTGAATTG -3'
(R):5'- CTGCTCATGGAATCCTGCTC -3'

Sequencing Primer
(F):5'- GACGCACACCTTGAATTGTAAAG -3'
(R):5'- AATACCCCCAGACTGGTGCTTG -3'
Posted On2018-03-15