Incidental Mutation 'R6271:Olfr1255'
ID507314
Institutional Source Beutler Lab
Gene Symbol Olfr1255
Ensembl Gene ENSMUSG00000045148
Gene Nameolfactory receptor 1255
SynonymsGA_x6K02T2Q125-51257221-51258135, MOR232-4
MMRRC Submission 044379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6271 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89812051-89817860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89816562 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 73 (S73P)
Ref Sequence ENSEMBL: ENSMUSP00000150299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057369] [ENSMUST00000214508]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057369
AA Change: S79P

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060602
Gene: ENSMUSG00000045148
AA Change: S79P

DomainStartEndE-ValueType
Pfam:7tm_4 35 309 5.2e-44 PFAM
Pfam:7tm_1 45 291 4.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214508
AA Change: S73P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 G T 4: 133,064,724 C1092F possibly damaging Het
Aplf T C 6: 87,646,248 E304G possibly damaging Het
Atp12a A G 14: 56,378,422 D547G probably benign Het
B3gat2 T C 1: 23,815,261 L212P probably damaging Het
Babam2 G T 5: 32,001,362 A219S probably damaging Het
Ccdc18 A C 5: 108,174,887 S618R possibly damaging Het
Ces2c G A 8: 104,852,116 G342D probably damaging Het
Cfap57 A C 4: 118,595,759 D582E probably benign Het
Cisd2 T C 3: 135,408,866 N115D possibly damaging Het
Cyp17a1 A G 19: 46,672,720 F42L probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam234a T C 17: 26,218,237 D156G probably benign Het
Fer1l6 T A 15: 58,641,918 I1554K probably benign Het
Fv1 A G 4: 147,870,017 T347A possibly damaging Het
Gm5134 T A 10: 75,995,809 C361S probably benign Het
Gm5415 T A 1: 32,545,491 D446V probably damaging Het
Grin3a T C 4: 49,792,516 I406V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifna13 A C 4: 88,643,845 L181V possibly damaging Het
Irx4 A G 13: 73,266,594 probably null Het
Kcna3 T A 3: 107,037,606 M395K probably damaging Het
Kcnma1 A T 14: 23,509,889 V347D probably damaging Het
Kng2 A T 16: 23,003,948 V218E probably benign Het
Krt36 G A 11: 100,104,472 Q167* probably null Het
Lama2 T C 10: 27,023,329 D2457G possibly damaging Het
Ldah G A 12: 8,268,599 probably null Het
Lhfpl3 G T 5: 22,746,244 A18S probably benign Het
Lrrk1 A G 7: 66,307,103 probably null Het
Ltv1 T C 10: 13,179,701 Y352C probably damaging Het
Lyst G T 13: 13,658,754 M1720I probably benign Het
Mkx A T 18: 6,937,059 probably null Het
Myo18a A G 11: 77,820,809 H626R probably damaging Het
Nop9 A C 14: 55,753,741 Q618H probably damaging Het
Olfr25 T C 9: 38,330,282 S232P probably benign Het
Olfr358 T C 2: 37,005,542 Q24R probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Otog C A 7: 46,252,040 Q388K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Oxct2b T G 4: 123,117,715 V476G probably damaging Het
Parp10 T C 15: 76,242,002 T329A probably benign Het
Pcdhga5 T C 18: 37,696,682 S728P probably benign Het
Piezo1 G T 8: 122,494,932 H574Q probably damaging Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Pqlc3 T C 12: 16,997,703 D76G probably damaging Het
Preb C A 5: 30,958,051 V255F probably damaging Het
Prmt9 A G 8: 77,577,463 N725S probably damaging Het
Ric1 A T 19: 29,567,365 probably null Het
Serinc3 G C 2: 163,630,976 L245V probably benign Het
Sgce T C 6: 4,730,015 K70E possibly damaging Het
Simc1 T G 13: 54,539,724 V102G probably damaging Het
Smyd2 A G 1: 189,883,852 Y362H probably damaging Het
Sptbn1 G T 11: 30,100,660 H2310N probably benign Het
Syne1 T C 10: 5,234,652 Y4077C probably damaging Het
Syne2 C A 12: 75,890,381 A251E probably damaging Het
Taok1 A T 11: 77,573,783 L159Q probably damaging Het
Timeless T C 10: 128,250,724 L1043P probably damaging Het
Tmprss3 T C 17: 31,186,562 E352G probably damaging Het
Trav6-4 A T 14: 53,454,582 T46S probably benign Het
Ubiad1 A T 4: 148,436,626 Y180* probably null Het
Usp47 A G 7: 112,087,056 E627G probably damaging Het
Vmn2r124 A G 17: 18,062,883 T280A probably benign Het
Other mutations in Olfr1255
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Olfr1255 APN 2 89816673 missense probably damaging 1.00
IGL02902:Olfr1255 APN 2 89817164 nonsense probably null
IGL03077:Olfr1255 APN 2 89817142 missense probably damaging 1.00
IGL03087:Olfr1255 APN 2 89816671 missense probably damaging 1.00
IGL03371:Olfr1255 APN 2 89817165 missense possibly damaging 0.64
R0683:Olfr1255 UTSW 2 89817178 missense probably damaging 1.00
R1428:Olfr1255 UTSW 2 89816381 missense probably damaging 1.00
R1567:Olfr1255 UTSW 2 89817184 missense probably damaging 1.00
R3810:Olfr1255 UTSW 2 89817051 missense probably damaging 1.00
R3812:Olfr1255 UTSW 2 89817051 missense probably damaging 1.00
R4900:Olfr1255 UTSW 2 89816968 missense possibly damaging 0.58
R5538:Olfr1255 UTSW 2 89816620 missense probably damaging 1.00
R5770:Olfr1255 UTSW 2 89816549 missense probably damaging 1.00
R5894:Olfr1255 UTSW 2 89817213 missense possibly damaging 0.59
R5942:Olfr1255 UTSW 2 89816340 nonsense probably null
R6263:Olfr1255 UTSW 2 89816760 missense probably damaging 1.00
R6651:Olfr1255 UTSW 2 89816896 missense probably benign 0.13
R7298:Olfr1255 UTSW 2 89816521 missense probably damaging 0.98
R7379:Olfr1255 UTSW 2 89816689 missense probably benign 0.00
R7465:Olfr1255 UTSW 2 89816536 missense probably damaging 1.00
R7546:Olfr1255 UTSW 2 89817019 missense probably benign 0.00
R7546:Olfr1255 UTSW 2 89817194 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGACTGAGTTCATCTTGATAGG -3'
(R):5'- GGAGAATGCATAGCTTGTGGC -3'

Sequencing Primer
(F):5'- TCTTGATAGGTCTTACACAGAACCC -3'
(R):5'- CTCATGATGGTCATATAGTGCAGAG -3'
Posted On2018-03-15