Incidental Mutation 'R6271:Ahdc1'
ID507322
Institutional Source Beutler Lab
Gene Symbol Ahdc1
Ensembl Gene ENSMUSG00000037692
Gene NameAT hook, DNA binding motif, containing 1
Synonyms
MMRRC Submission 044379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R6271 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location133011260-133078110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 133064724 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1092 (C1092F)
Ref Sequence ENSEMBL: ENSMUSP00000101536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044521] [ENSMUST00000105914] [ENSMUST00000105915] [ENSMUST00000105916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044521
AA Change: C1092F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047113
Gene: ENSMUSG00000037692
AA Change: C1092F

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105914
AA Change: C1092F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101534
Gene: ENSMUSG00000037692
AA Change: C1092F

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
Pfam:DUF4683 559 639 6.4e-15 PFAM
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105915
AA Change: C1092F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101535
Gene: ENSMUSG00000037692
AA Change: C1092F

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105916
AA Change: C1092F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101536
Gene: ENSMUSG00000037692
AA Change: C1092F

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156677
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two AT-hooks, which likely function in DNA binding. Mutations in this gene were found in individuals with Xia-Gibbs syndrome. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplf T C 6: 87,646,248 E304G possibly damaging Het
Atp12a A G 14: 56,378,422 D547G probably benign Het
B3gat2 T C 1: 23,815,261 L212P probably damaging Het
Babam2 G T 5: 32,001,362 A219S probably damaging Het
Ccdc18 A C 5: 108,174,887 S618R possibly damaging Het
Ces2c G A 8: 104,852,116 G342D probably damaging Het
Cfap57 A C 4: 118,595,759 D582E probably benign Het
Cisd2 T C 3: 135,408,866 N115D possibly damaging Het
Cyp17a1 A G 19: 46,672,720 F42L probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam234a T C 17: 26,218,237 D156G probably benign Het
Fer1l6 T A 15: 58,641,918 I1554K probably benign Het
Fv1 A G 4: 147,870,017 T347A possibly damaging Het
Gm5134 T A 10: 75,995,809 C361S probably benign Het
Gm5415 T A 1: 32,545,491 D446V probably damaging Het
Grin3a T C 4: 49,792,516 I406V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ifna13 A C 4: 88,643,845 L181V possibly damaging Het
Irx4 A G 13: 73,266,594 probably null Het
Kcna3 T A 3: 107,037,606 M395K probably damaging Het
Kcnma1 A T 14: 23,509,889 V347D probably damaging Het
Kng2 A T 16: 23,003,948 V218E probably benign Het
Krt36 G A 11: 100,104,472 Q167* probably null Het
Lama2 T C 10: 27,023,329 D2457G possibly damaging Het
Ldah G A 12: 8,268,599 probably null Het
Lhfpl3 G T 5: 22,746,244 A18S probably benign Het
Lrrk1 A G 7: 66,307,103 probably null Het
Ltv1 T C 10: 13,179,701 Y352C probably damaging Het
Lyst G T 13: 13,658,754 M1720I probably benign Het
Mkx A T 18: 6,937,059 probably null Het
Myo18a A G 11: 77,820,809 H626R probably damaging Het
Nop9 A C 14: 55,753,741 Q618H probably damaging Het
Olfr1255 T C 2: 89,816,562 S73P probably damaging Het
Olfr25 T C 9: 38,330,282 S232P probably benign Het
Olfr358 T C 2: 37,005,542 Q24R probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Otog C A 7: 46,252,040 Q388K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Oxct2b T G 4: 123,117,715 V476G probably damaging Het
Parp10 T C 15: 76,242,002 T329A probably benign Het
Pcdhga5 T C 18: 37,696,682 S728P probably benign Het
Piezo1 G T 8: 122,494,932 H574Q probably damaging Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Pqlc3 T C 12: 16,997,703 D76G probably damaging Het
Preb C A 5: 30,958,051 V255F probably damaging Het
Prmt9 A G 8: 77,577,463 N725S probably damaging Het
Ric1 A T 19: 29,567,365 probably null Het
Serinc3 G C 2: 163,630,976 L245V probably benign Het
Sgce T C 6: 4,730,015 K70E possibly damaging Het
Simc1 T G 13: 54,539,724 V102G probably damaging Het
Smyd2 A G 1: 189,883,852 Y362H probably damaging Het
Sptbn1 G T 11: 30,100,660 H2310N probably benign Het
Syne1 T C 10: 5,234,652 Y4077C probably damaging Het
Syne2 C A 12: 75,890,381 A251E probably damaging Het
Taok1 A T 11: 77,573,783 L159Q probably damaging Het
Timeless T C 10: 128,250,724 L1043P probably damaging Het
Tmprss3 T C 17: 31,186,562 E352G probably damaging Het
Trav6-4 A T 14: 53,454,582 T46S probably benign Het
Ubiad1 A T 4: 148,436,626 Y180* probably null Het
Usp47 A G 7: 112,087,056 E627G probably damaging Het
Vmn2r124 A G 17: 18,062,883 T280A probably benign Het
Other mutations in Ahdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Ahdc1 APN 4 133063062 missense probably benign 0.33
IGL02293:Ahdc1 APN 4 133065618 missense possibly damaging 0.85
IGL02338:Ahdc1 APN 4 133062549 missense possibly damaging 0.73
IGL02828:Ahdc1 APN 4 133062921 missense possibly damaging 0.96
IGL02859:Ahdc1 APN 4 133062692 missense possibly damaging 0.53
IGL02859:Ahdc1 APN 4 133062693 missense probably damaging 0.99
IGL02901:Ahdc1 APN 4 133064934 missense possibly damaging 0.85
IGL03323:Ahdc1 APN 4 133065428 missense probably benign
FR4304:Ahdc1 UTSW 4 133062759 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062757 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062760 small insertion probably benign
FR4737:Ahdc1 UTSW 4 133062759 small insertion probably benign
R0325:Ahdc1 UTSW 4 133062719 missense unknown
R0550:Ahdc1 UTSW 4 133063037 missense probably benign 0.33
R0681:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0683:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0731:Ahdc1 UTSW 4 133062951 missense possibly damaging 0.86
R0751:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1137:Ahdc1 UTSW 4 133062113 missense possibly damaging 0.68
R1184:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1331:Ahdc1 UTSW 4 133063691 missense probably benign 0.18
R1599:Ahdc1 UTSW 4 133064936 missense possibly damaging 0.91
R2202:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2205:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2261:Ahdc1 UTSW 4 133063163 missense unknown
R2262:Ahdc1 UTSW 4 133063163 missense unknown
R3683:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3684:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3685:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3713:Ahdc1 UTSW 4 133065986 missense possibly damaging 0.85
R4027:Ahdc1 UTSW 4 133064165 missense possibly damaging 0.73
R4807:Ahdc1 UTSW 4 133064313 missense possibly damaging 0.86
R4987:Ahdc1 UTSW 4 133064320 missense possibly damaging 0.53
R5126:Ahdc1 UTSW 4 133063522 missense probably benign 0.18
R5276:Ahdc1 UTSW 4 133062798 missense possibly damaging 0.93
R5680:Ahdc1 UTSW 4 133065596 missense probably benign
R5997:Ahdc1 UTSW 4 133063895 missense probably benign 0.05
R6050:Ahdc1 UTSW 4 133065891 missense possibly damaging 0.85
R6410:Ahdc1 UTSW 4 133062899 missense probably damaging 0.97
R6519:Ahdc1 UTSW 4 133064768 missense possibly damaging 0.86
R6970:Ahdc1 UTSW 4 133062345 missense possibly damaging 0.96
R7199:Ahdc1 UTSW 4 133064624 missense probably benign 0.33
R7202:Ahdc1 UTSW 4 133061887 nonsense probably null
T0722:Ahdc1 UTSW 4 133062754 small insertion probably benign
T0975:Ahdc1 UTSW 4 133062754 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTCTTCAACAGCTCTGAGG -3'
(R):5'- TGACTGAACTGGGTGCTGTC -3'

Sequencing Primer
(F):5'- GGGGGCCCCTTCTCTGG -3'
(R):5'- TGACTCGGAGAAGGTCTCG -3'
Posted On2018-03-15